ID: 1056273953

View in Genome Browser
Species Human (GRCh38)
Location 9:84974822-84974844
Sequence GACTTCCTTGAGGCTGCTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 109}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056273953_1056273967 29 Left 1056273953 9:84974822-84974844 CCCTAAGCAGCCTCAAGGAAGTC 0: 1
1: 0
2: 0
3: 6
4: 109
Right 1056273967 9:84974874-84974896 GCCTGGATATCCCCTGGGTGTGG No data
1056273953_1056273966 24 Left 1056273953 9:84974822-84974844 CCCTAAGCAGCCTCAAGGAAGTC 0: 1
1: 0
2: 0
3: 6
4: 109
Right 1056273966 9:84974869-84974891 AGCAGGCCTGGATATCCCCTGGG No data
1056273953_1056273965 23 Left 1056273953 9:84974822-84974844 CCCTAAGCAGCCTCAAGGAAGTC 0: 1
1: 0
2: 0
3: 6
4: 109
Right 1056273965 9:84974868-84974890 GAGCAGGCCTGGATATCCCCTGG No data
1056273953_1056273958 -9 Left 1056273953 9:84974822-84974844 CCCTAAGCAGCCTCAAGGAAGTC 0: 1
1: 0
2: 0
3: 6
4: 109
Right 1056273958 9:84974836-84974858 AAGGAAGTCGCCGGCTGTTTGGG No data
1056273953_1056273963 7 Left 1056273953 9:84974822-84974844 CCCTAAGCAGCCTCAAGGAAGTC 0: 1
1: 0
2: 0
3: 6
4: 109
Right 1056273963 9:84974852-84974874 GTTTGGGAGTTAAGGGGAGCAGG No data
1056273953_1056273957 -10 Left 1056273953 9:84974822-84974844 CCCTAAGCAGCCTCAAGGAAGTC 0: 1
1: 0
2: 0
3: 6
4: 109
Right 1056273957 9:84974835-84974857 CAAGGAAGTCGCCGGCTGTTTGG No data
1056273953_1056273959 -1 Left 1056273953 9:84974822-84974844 CCCTAAGCAGCCTCAAGGAAGTC 0: 1
1: 0
2: 0
3: 6
4: 109
Right 1056273959 9:84974844-84974866 CGCCGGCTGTTTGGGAGTTAAGG No data
1056273953_1056273962 1 Left 1056273953 9:84974822-84974844 CCCTAAGCAGCCTCAAGGAAGTC 0: 1
1: 0
2: 0
3: 6
4: 109
Right 1056273962 9:84974846-84974868 CCGGCTGTTTGGGAGTTAAGGGG No data
1056273953_1056273964 12 Left 1056273953 9:84974822-84974844 CCCTAAGCAGCCTCAAGGAAGTC 0: 1
1: 0
2: 0
3: 6
4: 109
Right 1056273964 9:84974857-84974879 GGAGTTAAGGGGAGCAGGCCTGG No data
1056273953_1056273960 0 Left 1056273953 9:84974822-84974844 CCCTAAGCAGCCTCAAGGAAGTC 0: 1
1: 0
2: 0
3: 6
4: 109
Right 1056273960 9:84974845-84974867 GCCGGCTGTTTGGGAGTTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056273953 Original CRISPR GACTTCCTTGAGGCTGCTTA GGG (reversed) Intronic
901943936 1:12685531-12685553 GGCTTCCCTGAGGCTTCCTAAGG + Intergenic
902225806 1:14995856-14995878 GATTTTCTTGAGTCTGCTTGGGG + Intronic
912332797 1:108834852-108834874 GCCTTCCTGGAGGCTGCATGAGG + Intronic
912451863 1:109772365-109772387 GACTTTCAGGAGGCTGTTTATGG - Intronic
916261498 1:162846796-162846818 GACTTCCTAGATGTTGCTTCTGG - Intronic
919378492 1:196824112-196824134 CAATTCCTTGAGGATGCTAAAGG - Intronic
922079936 1:222285790-222285812 AACTTCCCTGTAGCTGCTTAGGG - Intergenic
1067710009 10:48641868-48641890 GACTTTGCTGAGGTTGCTTAAGG - Intronic
1069675842 10:70246796-70246818 GACTTATTTCAGGCTTCTTATGG + Intergenic
1073404625 10:103286361-103286383 GAATTCCTTCTGGCTGCTCAAGG + Intronic
1075503297 10:122998021-122998043 GACCTCCTTGAGCCTGCTAGAGG - Intronic
1075807301 10:125199012-125199034 GAGTGCCTGGAGGCTTCTTAGGG + Intergenic
1083208012 11:61164935-61164957 GACATCCTTGAGGCTGGAGAGGG - Intergenic
1083883921 11:65561627-65561649 GGATCCCTCGAGGCTGCTTAAGG - Intergenic
1088526472 11:110761637-110761659 GACTACCTTGATGCTACTTCTGG + Intergenic
1088938630 11:114430865-114430887 GACATCCTTGTGGCTGGGTATGG - Intronic
1092816014 12:12312910-12312932 GACTCCCTCCAGGCTGCTCAGGG - Intergenic
1093178660 12:15943108-15943130 CACTTACCTGAGGCTGTTTATGG + Intronic
1107399357 13:40054004-40054026 GTCTCCCTTGCGGCTGGTTATGG + Intergenic
1110196988 13:72800972-72800994 GTCTTCCTTGAGACAGCTCAGGG + Intronic
1110254584 13:73418529-73418551 CACTATGTTGAGGCTGCTTATGG + Intergenic
1112599714 13:100843031-100843053 GACTTCTTTGAGTCTTCTTGTGG + Intergenic
1118482238 14:66178928-66178950 GATTTCCATCTGGCTGCTTAAGG - Intergenic
1118939916 14:70324146-70324168 TACTTCCTGGAGGCTGATCATGG - Intergenic
1122548447 14:102537698-102537720 GACCTCCTGGAGGCTGGATAAGG - Intergenic
1125276185 15:37994714-37994736 GACCTCCTTGTGGCTGAATACGG - Intergenic
1125374856 15:39017802-39017824 GACTTCCTTGAGGCTCAGTGGGG + Intergenic
1126224211 15:46251288-46251310 GACTCCCTGGAGGCTGAATATGG + Intergenic
1127932534 15:63606378-63606400 CGTTTGCTTGAGGCTGCTTAAGG + Intergenic
1130367478 15:83253478-83253500 CACATCCTTGAGGCAGCTAAAGG + Intergenic
1132243666 15:100278800-100278822 GATTTCCCTGTGGCTGGTTAGGG + Intronic
1133072533 16:3256102-3256124 AACTTCCTTCAGGCTCCTAATGG - Intronic
1138209312 16:55149858-55149880 GACCTCCTTTGGCCTGCTTAAGG - Intergenic
1140079286 16:71729477-71729499 GACTTCCAAGAGGCTGATTCTGG - Intronic
1140750827 16:78021967-78021989 TACTTCCTTGGGGCTGCATGTGG - Intergenic
1141300768 16:82813578-82813600 GTCTTCCCGGAGGCTGCTTGTGG + Intronic
1144295552 17:13871901-13871923 GCCTTTGTTGAGGCTGCTGAGGG - Intergenic
1144656403 17:17040047-17040069 GCCTTCCCTGAAGCTGCCTACGG + Intergenic
1145934576 17:28707237-28707259 GACTGTCTTGTGGCTGCTAATGG - Intronic
1155465782 18:26133833-26133855 GACTTCCGGGAGGCAGCTTGAGG + Intronic
1163048998 19:14667094-14667116 GACCTCAGTCAGGCTGCTTATGG + Intronic
1165492174 19:36130357-36130379 GAGTTCCTTGAGGCCAGTTAAGG + Intergenic
1165824921 19:38700268-38700290 GTCTCCCTTGAGGCAGCTTGGGG + Intronic
931392419 2:61855173-61855195 CACTTCCTTCAGGCTGCTCTTGG + Intergenic
937096634 2:119239809-119239831 CACTTCCTTGGGGCTTCTTAAGG + Intronic
939390846 2:141568084-141568106 GACTTGCTTGCTGCTCCTTAAGG + Intronic
939482766 2:142770339-142770361 AACTTCCTAGAGACTGGTTAAGG + Intergenic
942045192 2:172095747-172095769 GGCTTCCCTGGGGCTGCTTTGGG + Intergenic
944083102 2:195812111-195812133 GTCTTCCCTGAGTCTGCTTCTGG - Intronic
945912835 2:215669147-215669169 GACTTCCTAGTGCCAGCTTAGGG + Intergenic
946072431 2:217046020-217046042 GACTTCCTTGGGGCTGGTGTTGG + Intergenic
947718633 2:232354223-232354245 GACCTCCTTGTGGCTGGTAAGGG + Intergenic
947927843 2:233937297-233937319 GATTTCATTGAGCCTGCTTATGG - Intronic
948875218 2:240822877-240822899 GAATTCATTGAGGCTTCTTTAGG + Intergenic
1175266194 20:57704849-57704871 GGCTTCCTTGGGGCTCCTGAGGG + Intronic
1175347321 20:58289423-58289445 GACTTCCCTGAGGCTAATTTTGG + Intergenic
1175483698 20:59329569-59329591 AACTTACTTAAGGCTTCTTATGG + Intergenic
1176096200 20:63345636-63345658 GACTCCCATGAGGCTTCTCAGGG + Exonic
1177212825 21:18091449-18091471 GACTCCCTTGCTTCTGCTTAAGG + Intronic
1178348792 21:31855430-31855452 GAATTCCTAGAGGCTGGTTATGG - Intergenic
1178680435 21:34669337-34669359 TCCTTCCTTGACGCTGCTTAAGG - Intergenic
1184636124 22:45833254-45833276 GACTTCCTGGGAGCTGCTGAAGG + Intronic
953480581 3:43248298-43248320 GAATGCCATGAGGCTGCTTGGGG - Intergenic
955078802 3:55638739-55638761 GACTTCCTTAAGGGTGGATAGGG + Intronic
957576456 3:82014632-82014654 CAGTGTCTTGAGGCTGCTTAGGG - Intergenic
957884341 3:86265500-86265522 AACTGCCTTGAGGATGCTTCTGG - Intergenic
960473728 3:118098394-118098416 AACTTTCATGAGGCTGCATAAGG + Intergenic
963846101 3:150159642-150159664 GACTTCTACGAGGCTGCTTTAGG + Intergenic
965633494 3:170757116-170757138 GACTTCTTTCATGCTGCTTCAGG + Intronic
969344318 4:6561795-6561817 GACTCCCTAGAGCCTGCTTGCGG - Intronic
973539420 4:51921518-51921540 GACATCCTGGAAGCTGCTTTTGG + Intergenic
977081104 4:92529350-92529372 GTCTTCCTAAAGGCTGTTTAAGG + Intronic
977544889 4:98365904-98365926 GACTTCTTTTTGGCTGCTCATGG - Intronic
978366911 4:107991845-107991867 ATGTTCCTGGAGGCTGCTTAAGG - Intronic
982174491 4:152692875-152692897 TACTTCATTGAGGATGCTTTTGG + Intronic
986716149 5:10525015-10525037 GAATTCTATGAGGCTGCTTCAGG + Intergenic
988603469 5:32660737-32660759 GACTTTTTTGAAGTTGCTTAAGG + Intergenic
988916360 5:35897704-35897726 TACTTCCTTGACGGTGCTTTTGG - Intergenic
990018693 5:51099192-51099214 GACCTCCTTGAGGTGGCTTGAGG + Intergenic
993894232 5:93512062-93512084 GACTTGCCTGAGGCTCCTGAAGG - Intergenic
995611397 5:113913871-113913893 GACTTCCTTTTGGCTGCTTTTGG + Intergenic
1001016503 5:168146416-168146438 GTCTTCCCTGAGGATGCTTGAGG - Intronic
1005395712 6:25379697-25379719 GCCTTCCTTGAGTCTCCTCAGGG + Intronic
1007004171 6:38344497-38344519 AACTTTCTTGAGGCTACTTCGGG + Intronic
1011153108 6:84297839-84297861 AAGTTCCTAGAGGCTGTTTATGG - Intergenic
1012986700 6:105883716-105883738 TGCTTCCTTGAGGCTGCATGTGG - Intergenic
1015090694 6:129353851-129353873 GACTTCATTGTTACTGCTTACGG - Intronic
1018589571 6:165404332-165404354 GACTTCCCTGTGGCTGCATGAGG + Intronic
1018836129 6:167485505-167485527 GAGCTCCTTGTGCCTGCTTAGGG + Intergenic
1023198099 7:37664109-37664131 GTCTTCCTTGAGTCTGTTCATGG - Intergenic
1026421499 7:70241908-70241930 TGCTTCATTGAGGATGCTTAGGG + Intronic
1026525072 7:71146376-71146398 GACTTCCTAGCAGCTCCTTAAGG + Intronic
1029276900 7:99410964-99410986 GACTTCCTTGAGTCAGCATAGGG - Intronic
1032446452 7:131988039-131988061 GTCTTCCTTGAGGCATCTCAAGG - Intergenic
1046607205 8:116384632-116384654 CAGTTCCTTGAGGCAGCATAGGG + Intergenic
1048308155 8:133297628-133297650 GACTTCCTTGTGTCTCCGTATGG + Intronic
1049313401 8:141946119-141946141 GGCTTCCTTGAGGCGGCTCCTGG + Intergenic
1049478982 8:142811057-142811079 CACCTCCTTGAGGCTGCCCAGGG + Intergenic
1050187753 9:2992874-2992896 GATTGCTTTGAGGATGCTTAGGG + Intergenic
1050802720 9:9636209-9636231 GACTTTCCTGAGGAGGCTTAAGG - Intronic
1053056629 9:34996847-34996869 CACCTCCTTGAGGCTGATCAGGG - Exonic
1055985992 9:82056828-82056850 GCCTTCATGGAGGCTGCTGAGGG - Intergenic
1056273953 9:84974822-84974844 GACTTCCTTGAGGCTGCTTAGGG - Intronic
1056585344 9:87924304-87924326 GCCTTCATGGAGGCTGCTGAGGG + Intergenic
1056611537 9:88128636-88128658 GCCTTCATGGAGGCTGCTGAGGG - Intergenic
1056689416 9:88793982-88794004 GACTTGCTGGAGGCTGAGTATGG + Intergenic
1057300293 9:93874662-93874684 CAGTTCCTTGAGGCTGCACAGGG + Intergenic
1187211684 X:17238239-17238261 GGCTTCCATGAGCCTCCTTATGG + Intergenic
1189140168 X:38596264-38596286 TACTTCCTTAATGCTGCTAATGG + Intronic
1190289287 X:48981593-48981615 GACCTGCTTCAGGCTGCTAATGG + Exonic
1193591371 X:83392229-83392251 GACTTCCTTGAACCTGACTATGG + Intergenic
1194586991 X:95747500-95747522 GACCTGCCTGAGGCTGTTTATGG - Intergenic
1195363202 X:104104775-104104797 GAATTCCTTGAGAATGCTGAAGG + Exonic
1196887022 X:120256240-120256262 GATTTCCTTTTGGCTTCTTAAGG + Exonic
1198628004 X:138601238-138601260 GACTGCCTTGAAGCTGACTATGG + Intergenic
1199988744 X:152971631-152971653 GACTCCCTTGAGGCTTATAATGG + Exonic