ID: 1056273954

View in Genome Browser
Species Human (GRCh38)
Location 9:84974823-84974845
Sequence CGACTTCCTTGAGGCTGCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 78}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056273954_1056273962 0 Left 1056273954 9:84974823-84974845 CCTAAGCAGCCTCAAGGAAGTCG 0: 1
1: 0
2: 0
3: 4
4: 78
Right 1056273962 9:84974846-84974868 CCGGCTGTTTGGGAGTTAAGGGG No data
1056273954_1056273958 -10 Left 1056273954 9:84974823-84974845 CCTAAGCAGCCTCAAGGAAGTCG 0: 1
1: 0
2: 0
3: 4
4: 78
Right 1056273958 9:84974836-84974858 AAGGAAGTCGCCGGCTGTTTGGG No data
1056273954_1056273960 -1 Left 1056273954 9:84974823-84974845 CCTAAGCAGCCTCAAGGAAGTCG 0: 1
1: 0
2: 0
3: 4
4: 78
Right 1056273960 9:84974845-84974867 GCCGGCTGTTTGGGAGTTAAGGG No data
1056273954_1056273959 -2 Left 1056273954 9:84974823-84974845 CCTAAGCAGCCTCAAGGAAGTCG 0: 1
1: 0
2: 0
3: 4
4: 78
Right 1056273959 9:84974844-84974866 CGCCGGCTGTTTGGGAGTTAAGG No data
1056273954_1056273966 23 Left 1056273954 9:84974823-84974845 CCTAAGCAGCCTCAAGGAAGTCG 0: 1
1: 0
2: 0
3: 4
4: 78
Right 1056273966 9:84974869-84974891 AGCAGGCCTGGATATCCCCTGGG No data
1056273954_1056273964 11 Left 1056273954 9:84974823-84974845 CCTAAGCAGCCTCAAGGAAGTCG 0: 1
1: 0
2: 0
3: 4
4: 78
Right 1056273964 9:84974857-84974879 GGAGTTAAGGGGAGCAGGCCTGG No data
1056273954_1056273965 22 Left 1056273954 9:84974823-84974845 CCTAAGCAGCCTCAAGGAAGTCG 0: 1
1: 0
2: 0
3: 4
4: 78
Right 1056273965 9:84974868-84974890 GAGCAGGCCTGGATATCCCCTGG No data
1056273954_1056273963 6 Left 1056273954 9:84974823-84974845 CCTAAGCAGCCTCAAGGAAGTCG 0: 1
1: 0
2: 0
3: 4
4: 78
Right 1056273963 9:84974852-84974874 GTTTGGGAGTTAAGGGGAGCAGG No data
1056273954_1056273967 28 Left 1056273954 9:84974823-84974845 CCTAAGCAGCCTCAAGGAAGTCG 0: 1
1: 0
2: 0
3: 4
4: 78
Right 1056273967 9:84974874-84974896 GCCTGGATATCCCCTGGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056273954 Original CRISPR CGACTTCCTTGAGGCTGCTT AGG (reversed) Intronic
902225805 1:14995855-14995877 AGATTTTCTTGAGTCTGCTTGGG + Intronic
902324343 1:15689329-15689351 CCACTTCCTTGGGGATGCCTAGG - Intronic
907277133 1:53322985-53323007 CGACTTTGTTCAGGCTTCTTTGG - Intronic
907750290 1:57256863-57256885 GGGCTTACTGGAGGCTGCTTTGG - Intronic
923928072 1:238658690-238658712 CTACTTACTTAAGGCTTCTTGGG - Intergenic
1066984548 10:42453829-42453851 GGACTTTGTTGAGGCTTCTTTGG - Intergenic
1070508685 10:77140226-77140248 CGTATTCCTGGAGGCTGCCTGGG - Intronic
1072436931 10:95422538-95422560 CCCCTTCCTTGAGCCTGCTGTGG + Intronic
1074393931 10:113081312-113081334 CTACTTCCCAAAGGCTGCTTGGG + Intronic
1074474129 10:113754259-113754281 CATCTTACTTGGGGCTGCTTGGG + Intronic
1075583742 10:123642653-123642675 CCCCATCATTGAGGCTGCTTAGG - Intergenic
1085157201 11:74306745-74306767 CGACTGCCTTGAGGCTTCCAAGG + Intronic
1085256247 11:75175247-75175269 CCACCTCCCTGAGGCTGCCTTGG + Intronic
1086802372 11:91193087-91193109 TGACTTTCTTCAGGCTTCTTAGG - Intergenic
1099741799 12:86647047-86647069 CATCTTCCATGAGGCTGTTTTGG - Intronic
1100007322 12:89909979-89910001 CGACTCCCTTTAGGCTAGTTAGG + Intergenic
1103139492 12:118536185-118536207 TGACTTCTGTTAGGCTGCTTGGG + Intergenic
1103792617 12:123482372-123482394 CAGCTTCATTCAGGCTGCTTAGG - Intronic
1104437599 12:128768226-128768248 GGACTCCCCTGCGGCTGCTTGGG + Intergenic
1111960533 13:94805088-94805110 CCACCTGCCTGAGGCTGCTTGGG - Intergenic
1113332277 13:109341484-109341506 CGGCATCGGTGAGGCTGCTTGGG - Intergenic
1113698310 13:112364514-112364536 CAACTGCATTGAAGCTGCTTTGG - Intergenic
1122977211 14:105175761-105175783 TGAAGTCCTTGAGGCTGCTGAGG + Intronic
1125074435 15:35596756-35596778 CTAGTAACTTGAGGCTGCTTTGG + Intergenic
1125374855 15:39017801-39017823 CGACTTCCTTGAGGCTCAGTGGG + Intergenic
1128234354 15:66057424-66057446 CAACTTCCTTGAGAATGCATTGG + Intronic
1132150789 15:99456814-99456836 CGACGTTTCTGAGGCTGCTTGGG - Intergenic
1132864982 16:2088829-2088851 CGAGGGCCTTGAGGCTGCCTGGG + Exonic
1134390659 16:13816931-13816953 AGACTTCCTTGAAGCTGTTTTGG - Intergenic
1140181185 16:72720155-72720177 CGAAATCCTTGCTGCTGCTTGGG - Intergenic
1143810814 17:9470364-9470386 CCACTTCCTTCCTGCTGCTTTGG + Intronic
1149869990 17:60172369-60172391 CCACTTCCTTCAGTCTTCTTGGG + Intergenic
1150793021 17:68214681-68214703 AGACTTTCTTGAGTCTGCTGAGG + Intergenic
1151151417 17:72091014-72091036 AGACTTGCTTGAGGCTCCTAGGG + Intergenic
1151180561 17:72324536-72324558 CAACCTTCTAGAGGCTGCTTTGG + Intergenic
1153565228 18:6412520-6412542 CCACTTCCAGGAGGCTGCGTAGG - Intronic
1162617841 19:11816035-11816057 CCACTTACTCCAGGCTGCTTGGG - Intronic
1162621807 19:11849473-11849495 CCACTTACTCCAGGCTGCTTGGG - Intronic
1162630880 19:11925845-11925867 CCACTTACTCCAGGCTGCTTGGG - Intronic
1162746513 19:12801687-12801709 GGACCCCCTTCAGGCTGCTTTGG - Intronic
1163377769 19:16944331-16944353 CGGCTTCCTGGAGGCAGCTCTGG - Intronic
1163711646 19:18850703-18850725 TGATGTCCTTGAGGCTGCTCTGG - Exonic
1165722800 19:38091595-38091617 CCACTCCCTGGAGGGTGCTTTGG - Intronic
1165824920 19:38700267-38700289 GGTCTCCCTTGAGGCAGCTTGGG + Intronic
928251335 2:29683799-29683821 CCACTTGCTTCAGGCTGCTGTGG + Intronic
935874590 2:107493197-107493219 CCACTTACTCGAGGCTTCTTGGG - Intergenic
936040619 2:109146643-109146665 CCATCTCCTTGAGGCTGCTTTGG + Intronic
941702461 2:168618414-168618436 TGACTTCCTTGTGACTGATTTGG - Intronic
941927712 2:170912979-170913001 CTACCTCCTTGAGGCTGATCAGG - Intergenic
942045191 2:172095746-172095768 AGGCTTCCCTGGGGCTGCTTTGG + Intergenic
945817200 2:214620251-214620273 TGGCTTCCTTGAATCTGCTTTGG + Intergenic
947633198 2:231666645-231666667 CGACACCCTAGAGGCTGCTGGGG + Intergenic
947718632 2:232354222-232354244 CGACCTCCTTGTGGCTGGTAAGG + Intergenic
1170516654 20:17137116-17137138 TGACTTCATTGCTGCTGCTTTGG - Intergenic
1170552769 20:17491373-17491395 CCTCTTCCCTGAGGCAGCTTTGG - Intergenic
1171420286 20:25013301-25013323 GGACTTTCTTGGGGCTACTTAGG - Intronic
1172908315 20:38386304-38386326 GGACTTTCTTGAGCCTGCTCTGG + Intergenic
1176122210 20:63459003-63459025 CGTCTGCCGTGAGGCTGCTGTGG - Intronic
1178383796 21:32133615-32133637 TGCCTTCCTTGAGGCAGCGTTGG + Intergenic
1184870746 22:47236558-47236580 TGAGTTCATTAAGGCTGCTTAGG + Intergenic
950449114 3:13055720-13055742 CCTCTTCCTTGAGGCAGCTCTGG - Intronic
953480582 3:43248299-43248321 AGAATGCCATGAGGCTGCTTGGG - Intergenic
955078290 3:55634299-55634321 AGACTGCCTTGAAGCTACTTGGG + Intronic
960329543 3:116341762-116341784 CGCCTTCCTTGACTCTGGTTCGG + Intronic
985674338 5:1223056-1223078 CGGCTTCCGAGAGGCTGCTCCGG - Exonic
995231549 5:109770465-109770487 CGTCTTCCTGGAGGCAGATTTGG + Exonic
1001178925 5:169500196-169500218 AGCCTTCCTTTAGCCTGCTTAGG + Intergenic
1006387592 6:33740012-33740034 CGACTTCCATGAGTCAACTTGGG + Intronic
1007004170 6:38344496-38344518 GAACTTTCTTGAGGCTACTTCGG + Intronic
1018836128 6:167485504-167485526 CGAGCTCCTTGTGCCTGCTTAGG + Intergenic
1019910086 7:4095035-4095057 TGACTTCCTCCAGGCTCCTTAGG + Intronic
1022089370 7:27097436-27097458 CTACTTCCCTGAGGCTGCTGAGG + Intergenic
1023487925 7:40706673-40706695 CAACTTTCTAGAGGCTGCTCTGG + Intronic
1029276901 7:99410965-99410987 TGACTTCCTTGAGTCAGCATAGG - Intronic
1029575132 7:101398533-101398555 TGACATCTTAGAGGCTGCTTGGG - Intronic
1031544556 7:123035329-123035351 TGTCTTCTTTGAGGATGCTTTGG + Intergenic
1046607204 8:116384631-116384653 CCAGTTCCTTGAGGCAGCATAGG + Intergenic
1053056630 9:34996848-34996870 CCACCTCCTTGAGGCTGATCAGG - Exonic
1053416036 9:37947319-37947341 TCACTACCTTGAGGCAGCTTGGG + Intronic
1056273954 9:84974823-84974845 CGACTTCCTTGAGGCTGCTTAGG - Intronic
1057607078 9:96506644-96506666 CAAATTCCTGGAAGCTGCTTTGG + Intronic
1196576833 X:117328202-117328224 ATACTTCATTGAGGCTGTTTGGG - Intergenic
1200939447 Y:8766742-8766764 AGACGTCCTTGAAGGTGCTTCGG - Intergenic