ID: 1056273959

View in Genome Browser
Species Human (GRCh38)
Location 9:84974844-84974866
Sequence CGCCGGCTGTTTGGGAGTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056273949_1056273959 24 Left 1056273949 9:84974797-84974819 CCTTATCCCTGCTGGCTTCAGCT 0: 1
1: 0
2: 5
3: 26
4: 287
Right 1056273959 9:84974844-84974866 CGCCGGCTGTTTGGGAGTTAAGG No data
1056273951_1056273959 17 Left 1056273951 9:84974804-84974826 CCTGCTGGCTTCAGCTTTCCCTA 0: 1
1: 0
2: 4
3: 97
4: 633
Right 1056273959 9:84974844-84974866 CGCCGGCTGTTTGGGAGTTAAGG No data
1056273953_1056273959 -1 Left 1056273953 9:84974822-84974844 CCCTAAGCAGCCTCAAGGAAGTC 0: 1
1: 0
2: 0
3: 6
4: 109
Right 1056273959 9:84974844-84974866 CGCCGGCTGTTTGGGAGTTAAGG No data
1056273950_1056273959 18 Left 1056273950 9:84974803-84974825 CCCTGCTGGCTTCAGCTTTCCCT 0: 1
1: 0
2: 5
3: 43
4: 579
Right 1056273959 9:84974844-84974866 CGCCGGCTGTTTGGGAGTTAAGG No data
1056273948_1056273959 29 Left 1056273948 9:84974792-84974814 CCTTGCCTTATCCCTGCTGGCTT 0: 1
1: 0
2: 2
3: 32
4: 281
Right 1056273959 9:84974844-84974866 CGCCGGCTGTTTGGGAGTTAAGG No data
1056273947_1056273959 30 Left 1056273947 9:84974791-84974813 CCCTTGCCTTATCCCTGCTGGCT 0: 1
1: 0
2: 2
3: 31
4: 261
Right 1056273959 9:84974844-84974866 CGCCGGCTGTTTGGGAGTTAAGG No data
1056273954_1056273959 -2 Left 1056273954 9:84974823-84974845 CCTAAGCAGCCTCAAGGAAGTCG 0: 1
1: 0
2: 0
3: 4
4: 78
Right 1056273959 9:84974844-84974866 CGCCGGCTGTTTGGGAGTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056273959 Original CRISPR CGCCGGCTGTTTGGGAGTTA AGG Intronic
No off target data available for this crispr