ID: 1056274715

View in Genome Browser
Species Human (GRCh38)
Location 9:84982967-84982989
Sequence AGTCACATGGGGTATAAATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 124}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056274715_1056274722 2 Left 1056274715 9:84982967-84982989 CCTAATTTATACCCCATGTGACT 0: 1
1: 0
2: 2
3: 12
4: 124
Right 1056274722 9:84982992-84983014 TGTTGGGCAAATCAAATATAGGG No data
1056274715_1056274721 1 Left 1056274715 9:84982967-84982989 CCTAATTTATACCCCATGTGACT 0: 1
1: 0
2: 2
3: 12
4: 124
Right 1056274721 9:84982991-84983013 TTGTTGGGCAAATCAAATATAGG No data
1056274715_1056274725 14 Left 1056274715 9:84982967-84982989 CCTAATTTATACCCCATGTGACT 0: 1
1: 0
2: 2
3: 12
4: 124
Right 1056274725 9:84983004-84983026 CAAATATAGGGAAGTGGGAAAGG No data
1056274715_1056274723 8 Left 1056274715 9:84982967-84982989 CCTAATTTATACCCCATGTGACT 0: 1
1: 0
2: 2
3: 12
4: 124
Right 1056274723 9:84982998-84983020 GCAAATCAAATATAGGGAAGTGG No data
1056274715_1056274724 9 Left 1056274715 9:84982967-84982989 CCTAATTTATACCCCATGTGACT 0: 1
1: 0
2: 2
3: 12
4: 124
Right 1056274724 9:84982999-84983021 CAAATCAAATATAGGGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056274715 Original CRISPR AGTCACATGGGGTATAAATT AGG (reversed) Intronic
908373836 1:63512868-63512890 AGTCACATGGAATGTGAATTTGG - Intronic
909319645 1:74267516-74267538 AGTGACATCGGCTATAAAATAGG + Intronic
909432967 1:75611224-75611246 AGTCACTTGGAGTATAAAGAGGG + Intergenic
910641425 1:89467062-89467084 AGTCATATAGAGTATATATTTGG + Intergenic
912174558 1:107140626-107140648 AGTCAGAAGGGGCATAAATCAGG - Intronic
919408431 1:197213506-197213528 AGTCACATGGGATTTTTATTAGG - Intergenic
919549469 1:198966454-198966476 AGACAAAGGGTGTATAAATTTGG - Intergenic
924132303 1:240923954-240923976 AGTCATATAGGCTATTAATTTGG + Intronic
1064029794 10:11876510-11876532 AGTCACATGGGTGATGAATTAGG - Intergenic
1065994240 10:31041468-31041490 ATTCATATGGGGAATAATTTTGG - Intergenic
1066032462 10:31442626-31442648 AGTCACCTGGGATATAAAACTGG + Intronic
1067355390 10:45519901-45519923 AGTCACCTGGGCTAGAAACTAGG - Intronic
1068589717 10:58841046-58841068 AGTCACATGGGGTGTAAATCTGG + Intergenic
1071980471 10:90999901-90999923 GGTCACATGAGGCATAAATGGGG - Intergenic
1072221150 10:93328648-93328670 AGTCTCATGTGGTATAATTAGGG + Intronic
1072246795 10:93550775-93550797 AGTCACATGGCTTCTAAATGTGG + Intergenic
1073252795 10:102132144-102132166 AGTAACAAGGGGTTTAAATCTGG + Intergenic
1073706121 10:105986525-105986547 AGTCTCATGACGTAGAAATTTGG - Intergenic
1074343779 10:112660501-112660523 ATTCACTTGGGGTTTAATTTAGG - Intronic
1079663372 11:23070900-23070922 TATCACATTGGGGATAAATTGGG + Intergenic
1080197262 11:29626603-29626625 AGTCACATGGTATATAATTAAGG - Intergenic
1081378645 11:42388693-42388715 GGTCACATGGTGTATGAATCAGG - Intergenic
1081483277 11:43508127-43508149 AGTCACATGGGGAGAAAAATAGG + Intergenic
1082743506 11:56937462-56937484 AGTCAGATGCGGTATAAAGAGGG - Intergenic
1083612731 11:64011841-64011863 AGTCAGATGGGGTCTAACTTGGG + Intronic
1086115164 11:83241868-83241890 TTTCAGATGGGGTATGAATTAGG + Intronic
1087153246 11:94877475-94877497 AGTCTCCTGGGGTTTAAAGTGGG - Intergenic
1091316963 11:134621257-134621279 AGTCACTTGGGGTAGGAAGTGGG + Intergenic
1092836519 12:12494317-12494339 AGTTGCATGGGTTACAAATTAGG + Intronic
1095423765 12:42052824-42052846 AGTGAGATGTGGAATAAATTGGG - Intergenic
1095972642 12:47913510-47913532 AATCACATAGCATATAAATTTGG - Intronic
1100642047 12:96491419-96491441 AGTCAGATGAGATATACATTTGG + Intronic
1103361956 12:120359801-120359823 AGTCACCTTTGGTATAAATCAGG + Intronic
1104604508 12:130178064-130178086 ATACACATAGGTTATAAATTAGG + Intergenic
1107866899 13:44711873-44711895 TGTCACATGAGGTAAAAATAAGG - Intergenic
1108993283 13:56692348-56692370 AATTACATTGGGAATAAATTTGG - Intergenic
1109777276 13:67057991-67058013 ATTCAAATTGGATATAAATTGGG - Intronic
1111189950 13:84794165-84794187 AGTCTCCTGGGAGATAAATTTGG + Intergenic
1111984283 13:95049934-95049956 AGTCACTTGGTTTATAAATGAGG - Intronic
1112528166 13:100173018-100173040 AGTCATATGGGGAAAAAATAAGG - Intronic
1112609833 13:100945569-100945591 GGTCAGATGGGGGATAGATTGGG - Intergenic
1113023492 13:105915278-105915300 ATTCACACAGGATATAAATTTGG - Intergenic
1120948388 14:90019447-90019469 GGTCACATGGGAGATGAATTGGG + Intronic
1121745891 14:96291839-96291861 AGTAAAATTTGGTATAAATTGGG - Intronic
1121996208 14:98605363-98605385 AGTCCCAATGGGTATAATTTTGG - Intergenic
1124122447 15:26900325-26900347 AGTCATATGGGATAAAAAATGGG + Intronic
1129317175 15:74752042-74752064 AGTGACATGGGGTATAAGAGGGG + Intronic
1130709014 15:86261144-86261166 AGTCACATGTGGAATGAATTAGG + Intronic
1131905654 15:97139210-97139232 AGTCACATAGAGTATAACTTTGG + Intergenic
1135161696 16:20102262-20102284 AGTCACCTGGGCTATAAACTCGG + Intergenic
1138414961 16:56866422-56866444 AGTCACTTGGGGCACAAACTAGG + Intronic
1138900754 16:61266865-61266887 AGTCACATTCGGTGTAACTTAGG - Intergenic
1141223925 16:82097542-82097564 AGTCACATGGGCTATCAGTTTGG + Intronic
1149575052 17:57705978-57706000 AGGCACATGTGGTGGAAATTGGG + Intergenic
1151614114 17:75197042-75197064 AGTCACCTGTATTATAAATTTGG - Intergenic
1156507476 18:37607482-37607504 AGTCACATTGTGCACAAATTGGG - Intergenic
1158860226 18:61584424-61584446 TGTCACATGGGGTATTAAGGAGG - Intergenic
1159699081 18:71601765-71601787 AGTCACAAGGGGTAGAAAGTTGG + Intergenic
925530784 2:4859967-4859989 AGTGGCATGGGATATAGATTAGG - Intergenic
926587001 2:14697567-14697589 GGTGACATGAGATATAAATTGGG + Intergenic
928127760 2:28628106-28628128 AGTCACAGGGGATAGAAGTTAGG + Intronic
930899216 2:56483145-56483167 AGTCACTTGGGTTAAAAACTCGG + Intergenic
939823690 2:146988104-146988126 AGTCACCAGAGGTATTAATTGGG + Intergenic
940798197 2:158103115-158103137 ATTCATATTGGGTAGAAATTTGG + Intronic
941317026 2:164006075-164006097 AGTCACATGGTTTATAAATGTGG + Intergenic
942995837 2:182258784-182258806 AGTAACATGGGGTAAGAATGGGG - Intronic
945565919 2:211399168-211399190 ATTCACATGGGGCATATAATGGG - Intronic
947013509 2:225591673-225591695 AGTCACATGGGGAGTAAATCTGG + Intronic
1170148925 20:13207357-13207379 AGTCACACGGTGTATTAATCGGG + Intergenic
1173400887 20:42724856-42724878 AATCACAAGGGGTATAAAAGAGG - Intronic
1178492631 21:33062833-33062855 AGTCACATGGTTAATAAATGAGG + Intergenic
1183934294 22:41253300-41253322 AGGCACATGGGGGCTAAAGTGGG + Intronic
949669736 3:6385719-6385741 AGTCATATGTGGTATGAGTTGGG + Intergenic
951050857 3:18091346-18091368 AGTCACATGGGTCTAAAATTTGG - Intronic
952030302 3:29133462-29133484 AGGCACATGGAGAATAAATATGG - Intergenic
953233141 3:41082281-41082303 GGTCATATGGGGAATATATTTGG + Intergenic
955497797 3:59554047-59554069 AGTGACATATGGTTTAAATTAGG + Intergenic
956545660 3:70399315-70399337 TGTTAAATGGGGTAGAAATTGGG + Intergenic
956608759 3:71100530-71100552 AGTCACATGGTGGAGAACTTAGG + Intronic
958730517 3:97955848-97955870 AGTCACATGCTGTATAGGTTTGG - Intronic
959269933 3:104193761-104193783 ATTCATATGAGGTAGAAATTAGG - Intergenic
962614457 3:137110913-137110935 AATCAAATGGGGTAGAAGTTAGG + Intergenic
962632374 3:137291460-137291482 AGTCACAGGTGGTTTAATTTAGG + Intergenic
963432213 3:145222794-145222816 AGGGACATGCGATATAAATTGGG + Intergenic
963967932 3:151394349-151394371 AATTACATGGGTTTTAAATTAGG - Intronic
965063533 3:163813599-163813621 AATCACAGGGCTTATAAATTAGG + Intergenic
965354805 3:167660507-167660529 AGTCAAATGGGCTTAAAATTTGG + Intergenic
968360481 3:198143563-198143585 AGTCAAATGGTCTATTAATTAGG - Intergenic
972928560 4:44041610-44041632 ACTCATAGGGGGTATAACTTTGG - Intergenic
977237997 4:94532052-94532074 AGTCAATAGGGTTATAAATTTGG - Intronic
979344098 4:119565579-119565601 AGTCTCCTAAGGTATAAATTAGG + Intronic
979524726 4:121705102-121705124 TGTCACCTGTAGTATAAATTGGG + Intergenic
979963814 4:127053225-127053247 AGTGATACGTGGTATAAATTTGG - Intergenic
981990407 4:150912771-150912793 AGTTCCATGTTGTATAAATTAGG + Intronic
983565633 4:169148487-169148509 AGTCTCATCGTGTATAATTTTGG - Intronic
983833551 4:172361677-172361699 AGTCAAAAGGGGCATAAAATGGG + Intronic
987148988 5:15019788-15019810 CTTCAAATGGGCTATAAATTAGG + Intergenic
987888154 5:23837924-23837946 AGTCACATTAGGGATAGATTAGG - Intergenic
990854284 5:60245978-60246000 AATCACATGGGGTGTAAATGGGG - Intronic
994793311 5:104260115-104260137 AGGCACAAGGGGGAGAAATTAGG + Intergenic
997681350 5:135753925-135753947 AGTCACATTGGGTATACAACTGG - Intergenic
998563225 5:143191775-143191797 AGGCACATTGGGCATAAACTTGG - Intronic
998602346 5:143597955-143597977 AGTCACATGGGCATTACATTGGG - Intergenic
1000100307 5:158009947-158009969 AGTCAGATGGGATATCAATGGGG - Intergenic
1000530633 5:162415570-162415592 ATTCAAATGGCGTATTAATTGGG + Intergenic
1000629014 5:163570714-163570736 AGGCACATGGGGGAGAAATTTGG + Intergenic
1000672650 5:164081251-164081273 AGTCTCACTGGCTATAAATTTGG - Intergenic
1004209589 6:13625435-13625457 AGTAAGATGGGGTACAACTTGGG - Intronic
1005975207 6:30792782-30792804 AGTCCCTTTGGATATAAATTTGG - Intergenic
1008632645 6:53378271-53378293 ATTGACATGAGGTATGAATTTGG - Intergenic
1010369794 6:75094567-75094589 AGTTAAATGGGGTATAAATTGGG + Intronic
1010939634 6:81901016-81901038 AAGGACATGGGGTATAACTTGGG + Intergenic
1011547267 6:88494787-88494809 GGTGAAATGGGGTATAATTTTGG + Intergenic
1011940683 6:92838583-92838605 AGACACATGAGGTAGAAAGTGGG + Intergenic
1012929959 6:105306550-105306572 AGTCACAGGGGATATAGACTGGG - Intronic
1014430364 6:121363328-121363350 ATTTACATGGGGTAAATATTTGG - Intergenic
1014558497 6:122862511-122862533 AGTCACGTTGGGTGTAAATGAGG + Intergenic
1019259519 7:73070-73092 AGTCAAATGGTCTATTAATTAGG + Intergenic
1020944846 7:14590519-14590541 AGTCACATGGGGTTTATGTTTGG - Intronic
1021144082 7:17064205-17064227 ACTTTCATGGGATATAAATTTGG - Intergenic
1031518843 7:122737629-122737651 AGAAACTTGGGGTAGAAATTTGG - Intronic
1034378677 7:150669111-150669133 AGTCACATTGTGTAGAAATGAGG - Intergenic
1039954700 8:42197974-42197996 TGTCACATGCAGTATAAACTGGG + Intronic
1041353282 8:56971829-56971851 AGTCACATAGGGTTTTAAGTGGG - Intronic
1042071785 8:64942924-64942946 AAACTCATGGGGTATAAGTTGGG - Intergenic
1048266673 8:132993307-132993329 AGCCACATGGGATATGAGTTTGG + Intronic
1051869489 9:21720490-21720512 AGACACATGGGGTTTAATTGTGG - Intergenic
1054780570 9:69162705-69162727 AGACACCTGGGGTATACACTTGG - Intronic
1055356246 9:75440093-75440115 AGTCACATGGCCTACAAATGGGG - Intergenic
1056274715 9:84982967-84982989 AGTCACATGGGGTATAAATTAGG - Intronic
1060199012 9:121641005-121641027 AGACAGATGGGGTATAAAGAGGG - Intronic
1060963918 9:127701257-127701279 AATCACATGATTTATAAATTTGG - Intronic
1062745182 9:138207393-138207415 AGTCAAATGGTCTATTAATTAGG - Intergenic
1187558127 X:20372611-20372633 AGCCCCATGGGGCATAAACTTGG + Intergenic
1188415391 X:29926959-29926981 AGTCACATTTGGTATAATCTTGG - Intronic
1188525852 X:31087051-31087073 AGTAACATGTGGTACAAAGTTGG - Intergenic
1192299699 X:69886796-69886818 AGTCAAATGGGGTTTGAACTGGG - Intronic
1194693470 X:97015178-97015200 AGATACATGGGGAAAAAATTAGG + Intronic
1195786525 X:108530016-108530038 AGAAACATTGGGTATAAATAGGG + Intronic