ID: 1056276844

View in Genome Browser
Species Human (GRCh38)
Location 9:85001927-85001949
Sequence ATCCTATTATGGAGCATCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056276832_1056276844 29 Left 1056276832 9:85001875-85001897 CCAGAATTTCTGAATAGGGCAGG 0: 1
1: 0
2: 0
3: 14
4: 135
Right 1056276844 9:85001927-85001949 ATCCTATTATGGAGCATCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056276844 Original CRISPR ATCCTATTATGGAGCATCAG AGG Intronic
No off target data available for this crispr