ID: 1056276980

View in Genome Browser
Species Human (GRCh38)
Location 9:85002970-85002992
Sequence TTGGAGAAACAGTTGGGGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056276973_1056276980 -3 Left 1056276973 9:85002950-85002972 CCAGTAGGTGGCCTGCTGAGTTG 0: 1
1: 0
2: 1
3: 15
4: 152
Right 1056276980 9:85002970-85002992 TTGGAGAAACAGTTGGGGGACGG No data
1056276970_1056276980 19 Left 1056276970 9:85002928-85002950 CCAGGCTAGGAGGTGAGGGGCTC 0: 1
1: 0
2: 18
3: 762
4: 3358
Right 1056276980 9:85002970-85002992 TTGGAGAAACAGTTGGGGGACGG No data
1056276965_1056276980 29 Left 1056276965 9:85002918-85002940 CCAGGTCAGGCCAGGCTAGGAGG 0: 1
1: 0
2: 2
3: 33
4: 312
Right 1056276980 9:85002970-85002992 TTGGAGAAACAGTTGGGGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056276980 Original CRISPR TTGGAGAAACAGTTGGGGGA CGG Intronic
No off target data available for this crispr