ID: 1056278910

View in Genome Browser
Species Human (GRCh38)
Location 9:85020462-85020484
Sequence CACGATCTTATGGGCTTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 42}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056278905_1056278910 8 Left 1056278905 9:85020431-85020453 CCTTGTTTTGGGTTGGAAGACCA 0: 1
1: 0
2: 0
3: 7
4: 125
Right 1056278910 9:85020462-85020484 CACGATCTTATGGGCTTTGTTGG 0: 1
1: 0
2: 0
3: 4
4: 42
1056278901_1056278910 21 Left 1056278901 9:85020418-85020440 CCATTGGCTGGGGCCTTGTTTTG 0: 1
1: 0
2: 1
3: 9
4: 188
Right 1056278910 9:85020462-85020484 CACGATCTTATGGGCTTTGTTGG 0: 1
1: 0
2: 0
3: 4
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056278910 Original CRISPR CACGATCTTATGGGCTTTGT TGG Intronic
901588629 1:10319851-10319873 GACCATCTTGTGTGCTTTGTGGG + Intronic
905938094 1:41840711-41840733 CAGGATCTGATGGGCTCCGTGGG - Intronic
915143120 1:153779052-153779074 CAGGGCCTTATGGGCTTGGTGGG - Intronic
1069869288 10:71523437-71523459 CTCCATCTTTTGGGCTGTGTTGG - Intronic
1076291569 10:129349629-129349651 CACGTTCTTAGGGGCGTTTTGGG - Intergenic
1093337752 12:17929146-17929168 CACCATCTTTTGGCCTTTGAAGG + Intergenic
1101211366 12:102538273-102538295 CACGACCTTGTGGGCCTTGTGGG + Intergenic
1121159953 14:91728506-91728528 CAGGATCTTCTGGGCTTGGGTGG + Intronic
1128838786 15:70832700-70832722 CATGAACTCATGGGCTTTGATGG + Exonic
1131288959 15:91088181-91088203 CATGATCTCATGGACTTTTTGGG - Intergenic
1141447466 16:84070692-84070714 CTCGGTCTTATGGCCTTGGTCGG - Exonic
1143596752 17:7919000-7919022 CACGATTCTATGGGCTTGCTGGG - Intergenic
1144566110 17:16360773-16360795 CAGGATCTTATATGCTTTCTTGG + Intergenic
1145020897 17:19429879-19429901 CATGATCTCTTCGGCTTTGTGGG - Intergenic
935851400 2:107223927-107223949 TACGATCTAATAGGTTTTGTTGG - Intergenic
937487842 2:122334449-122334471 CAGGGTCTTACTGGCTTTGTTGG - Intergenic
938106818 2:128537249-128537271 CCCGATCTCTTTGGCTTTGTAGG + Intergenic
940783830 2:157960788-157960810 AAAGTGCTTATGGGCTTTGTAGG + Intronic
940792816 2:158045976-158045998 TATGATCTTGTGGGCTTTGAGGG - Intronic
941578962 2:167271224-167271246 ATCAAACTTATGGGCTTTGTGGG - Intergenic
1171938718 20:31303020-31303042 CAACATCTTATTGGCTTTATTGG + Intergenic
1175060349 20:56236492-56236514 CAAGATCTGATGGGCTTATTAGG + Intergenic
1177217740 21:18151340-18151362 CACTATCTTTTGGGCCTTTTAGG - Intronic
1180027824 21:45178360-45178382 CACGTTCCTCTGGGCTCTGTAGG + Intronic
1183308861 22:37098413-37098435 TACCATCTTCTGGGCTTTGGCGG + Exonic
949963206 3:9331905-9331927 CACTATTTTATGGGTTTTCTGGG - Intronic
972810914 4:42584926-42584948 CCAGATCCTATGGGCTTTGTAGG - Intronic
981051850 4:140317075-140317097 CATGATCTTAAGGGCTTTTCAGG + Intronic
1006228754 6:32564065-32564087 CACCATCTTCTGGACTTTTTTGG + Intronic
1012306726 6:97668079-97668101 CATGATCATATGTGGTTTGTGGG + Intergenic
1015581283 6:134728261-134728283 CTCGTTCTTTTGGGCTTTGATGG - Intergenic
1017867556 6:158457020-158457042 CACTATCTTACGGGCTATGTTGG + Intronic
1019016523 6:168884433-168884455 CACGTTCAGATGGGCCTTGTTGG + Intergenic
1024824656 7:53377762-53377784 CACTGTGTTTTGGGCTTTGTTGG - Intergenic
1033740785 7:144274223-144274245 GACCATCTTATGGTTTTTGTGGG - Intergenic
1033753121 7:144375390-144375412 GACCATCTTATGGTTTTTGTGGG + Intronic
1036504996 8:9347225-9347247 CACGATCTCAGAGGCTCTGTGGG + Intergenic
1041214838 8:55590294-55590316 CAGGATGTTATGGACTTTGAGGG + Intergenic
1052359543 9:27539459-27539481 TACGATCGTATGGGCTTAGTTGG + Intergenic
1052460922 9:28761955-28761977 CACGATGTGATGTGCATTGTAGG - Intergenic
1056278910 9:85020462-85020484 CACGATCTTATGGGCTTTGTTGG + Intronic
1061752310 9:132788065-132788087 CACAATATGATGGACTTTGTGGG + Intronic
1185514567 X:689512-689534 CAGGAGCTTATGAGCTTAGTAGG + Intergenic
1190582546 X:51903041-51903063 CAGGATCTTATGGGCAGTGAAGG + Intergenic
1192627033 X:72739757-72739779 CATCATCTCATGGGCTTAGTGGG + Intergenic
1198229356 X:134674661-134674683 CACTTTCCTATGGGCTATGTTGG + Intronic
1201011365 Y:9550293-9550315 CCCAATCTTATGGGGTTGGTAGG - Intergenic