ID: 1056279348

View in Genome Browser
Species Human (GRCh38)
Location 9:85025540-85025562
Sequence CAGGATTACCTGGTCAAGTA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 98}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056279344_1056279348 -1 Left 1056279344 9:85025518-85025540 CCTTTTCAAAGCGTCCTAACAGC 0: 1
1: 0
2: 0
3: 29
4: 70
Right 1056279348 9:85025540-85025562 CAGGATTACCTGGTCAAGTATGG 0: 1
1: 0
2: 0
3: 3
4: 98
1056279343_1056279348 23 Left 1056279343 9:85025494-85025516 CCAACTAACAGTATAGAATGCTG 0: 1
1: 0
2: 2
3: 13
4: 153
Right 1056279348 9:85025540-85025562 CAGGATTACCTGGTCAAGTATGG 0: 1
1: 0
2: 0
3: 3
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056279348 Original CRISPR CAGGATTACCTGGTCAAGTA TGG Exonic
900506991 1:3034704-3034726 CAGGATTTCCTGGACAAGCCTGG + Intergenic
906605457 1:47166673-47166695 GAGGATTACCTGGCCATGTGAGG - Intergenic
910436303 1:87209339-87209361 CAGGATCACCTGGTCAGTTCAGG - Intergenic
910502775 1:87912135-87912157 TAGGATCAGCTTGTCAAGTAAGG + Intergenic
912724734 1:112048908-112048930 CAGAAGTTCCTGGTAAAGTAAGG + Intergenic
920010016 1:202860784-202860806 CAGGAATCCCTAGTCAAGTATGG + Intergenic
920456608 1:206106518-206106540 CAGGAGAACCGGGTCAAGTGAGG + Intergenic
920569941 1:207008907-207008929 CAGGAGTAATTGGTCAAGAATGG - Intronic
1064905256 10:20339218-20339240 AAGGAGTACCTGGTCATGTGAGG + Intergenic
1065476866 10:26147842-26147864 CAGAATTACCTGGGCAAATCAGG + Intronic
1072395810 10:95039614-95039636 CAGGATCATCAGGTCAGGTAAGG + Intronic
1073121725 10:101125974-101125996 CAGGATCACCTGGTGACTTAGGG - Intronic
1073244634 10:102081040-102081062 CAGGCTACCCTGGGCAAGTAAGG - Intergenic
1073841211 10:107501240-107501262 CAGGATTTCCTGGTTGAGTCAGG + Intergenic
1078782820 11:14455793-14455815 AAGGATTCCCTGGTAAAGTAAGG + Intronic
1079158987 11:17975133-17975155 CAAGATCACCTTGTCAAGTTTGG - Intronic
1086678595 11:89640593-89640615 CAGGATTCCCTGGTGAATAAAGG + Intergenic
1087770281 11:102202013-102202035 CAGCTTGACCTGGTCAAATATGG + Intronic
1096593511 12:52678536-52678558 GAGGATTACCGGAACAAGTAAGG - Exonic
1106704411 13:32265378-32265400 CAGGACAACCTGTTCAACTAAGG - Intronic
1107719804 13:43236115-43236137 CAGGCTTCCCTGTCCAAGTATGG - Intronic
1112004852 13:95245403-95245425 CAGGATTTCCTGGCCCAGTTTGG - Intronic
1112433174 13:99370799-99370821 CAGGATTAACAGGTGGAGTATGG + Intronic
1115488926 14:33940122-33940144 CAAGATGACTTGGACAAGTAGGG - Intronic
1115514834 14:34174868-34174890 CAGCATGACCTGGTCCAGTGTGG + Intronic
1116704977 14:48285078-48285100 GAGGAGTACCTGGTCATGTGAGG + Intergenic
1118902354 14:69997197-69997219 CAGGCTTACCTGGGCATGTCAGG - Intronic
1121883452 14:97521431-97521453 CAAGATTGCAAGGTCAAGTATGG - Intergenic
1134293235 16:12921199-12921221 CAGCATAACCTGAGCAAGTAAGG + Intronic
1142688294 17:1590593-1590615 CAGGGTTTCCTGGTCCAGGAGGG - Intronic
1149601530 17:57896040-57896062 CCGGATTACCTGGGCATGTTCGG - Intronic
1149811619 17:59679506-59679528 CAATGTTACCTGGTCAATTAGGG - Exonic
1151943520 17:77306975-77306997 CAGGGTTACCTGGGGGAGTAGGG + Intronic
1152791432 17:82282489-82282511 CTGGTTTACCTGGTCAGGTGAGG + Intergenic
1152970076 18:153247-153269 AAGTATTTCCTGGCCAAGTATGG - Intergenic
1153539379 18:6137400-6137422 CAGGATTGCCTGATAAAGCATGG + Intronic
1155252815 18:23967950-23967972 CAGGACTCCCTGGTGAAATAAGG - Intergenic
1156016624 18:32553837-32553859 CAGGATTAGGAGGTCAAGGAGGG - Intergenic
1157654505 18:49371616-49371638 CAGTATTACCTTGGCAAGAATGG + Intronic
1159652088 18:70989181-70989203 CAGAATTATCTGGGGAAGTATGG - Intergenic
1159666816 18:71171413-71171435 CAGGATTGCCTGGAGAACTAGGG + Intergenic
1165430601 19:35769694-35769716 CAGGATTTCCTGGTTAACTGTGG - Intronic
1168282592 19:55313355-55313377 CTGGATGTCCTGGACAAGTAGGG - Intronic
925358008 2:3256208-3256230 CAGGTTTCCCTCGTCAGGTATGG - Intronic
925492200 2:4407411-4407433 CAGGGTTACCTGATGAAGTCAGG - Intergenic
927426861 2:22990662-22990684 CAGGTTTACCTGGACAATTGAGG - Intergenic
934655501 2:96115115-96115137 CAGGAGCACCTGGCCACGTAGGG + Exonic
936744539 2:115558984-115559006 CAAGCTTTCCAGGTCAAGTAGGG + Intronic
937496231 2:122423047-122423069 CATGATTGCCTGGTCAAGAGAGG - Intergenic
937530344 2:122820073-122820095 CCTGATTACCTAGTCAAGAAAGG + Intergenic
938320563 2:130359594-130359616 CAGGATCACCTAGACAAGGAGGG - Exonic
943808411 2:192152923-192152945 AAGGATGAACTGGTCAAGTCAGG + Intronic
945264079 2:207873012-207873034 TAGCATTACCTGATCATGTAGGG + Intronic
945375187 2:209071422-209071444 CAGGAGTTCCTGCTCAAGTGGGG + Intergenic
1171898665 20:30835704-30835726 CAGGAGTACCTGGCCATGTTAGG + Intergenic
1176697660 21:9999822-9999844 CATCATTTCCTGGACAAGTAGGG - Intergenic
1179340490 21:40503847-40503869 CTGAATTACCAGGTCAAATACGG - Intronic
1179627422 21:42656523-42656545 CAGGGTTACCTGCACAGGTAAGG - Intronic
958892283 3:99795220-99795242 CAGGTTTCCTTGGTGAAGTAGGG + Exonic
959177402 3:102932335-102932357 CTGGTTTACCTGTTCAACTAAGG + Intergenic
960313516 3:116146997-116147019 CAGGATTTCATGGTTAAGAAGGG + Intronic
960395517 3:117132067-117132089 AAGGATTTCATGGTCTAGTAGGG - Intronic
960937519 3:122912834-122912856 CAGGGTTACCTGGGCAAGCCTGG + Exonic
970586624 4:17520694-17520716 AAGGATTGCCTGGTTAAGAAAGG + Intronic
971231774 4:24806037-24806059 CAGGGTTATCTAGTGAAGTAGGG + Intergenic
980370202 4:131859706-131859728 CATCATTTCCTGGACAAGTAGGG - Intergenic
982807291 4:159782305-159782327 CAAGAATACCTGGCTAAGTAAGG - Intergenic
983518039 4:168677811-168677833 CAGGATTAACTGGCGGAGTAGGG - Intronic
990967047 5:61460170-61460192 CAAGACTACCTGGACATGTATGG - Intronic
991957822 5:72013580-72013602 CAGGATTGTCTGGGCAAATAAGG - Intergenic
1008722598 6:54374838-54374860 CAAAATTTCCTGTTCAAGTAGGG + Intronic
1011759421 6:90545044-90545066 CAGGAATACATGTTCAAGTTAGG + Intronic
1012925561 6:105263702-105263724 CAGGAGGACCTGGTCATGTGGGG + Intergenic
1013010045 6:106112027-106112049 CAGGATAATCTGGTCTAGAAAGG + Intergenic
1020872593 7:13650494-13650516 CAGGATTATCTGTTCAAGTGAGG + Intergenic
1021216456 7:17921646-17921668 TAGCATTACCTGGGGAAGTAGGG + Intronic
1021273267 7:18618454-18618476 CAGGATTTCATGGTCCAGAAAGG - Intronic
1028938966 7:96498788-96498810 CAGGGTTACTTGGACAAGTCAGG - Intronic
1029899872 7:104027805-104027827 CAGGCTTACTTGGTTAAGTTTGG + Intergenic
1041812336 8:61925726-61925748 TACGATTCCCTGCTCAAGTAGGG - Intergenic
1047789617 8:128189643-128189665 CAGGATTCCCTAGTCTAGTCTGG + Intergenic
1047911727 8:129537215-129537237 CAGGATAATCTGGACAAATAGGG - Intergenic
1050355451 9:4778620-4778642 AAGGATTACCTTTTCAAGAAGGG - Intergenic
1053634778 9:39986193-39986215 CATCATTTCCTGGACAAGTAGGG - Intergenic
1053771148 9:41478143-41478165 CATCATTTCCTGGACAAGTAGGG + Intergenic
1054209109 9:62264504-62264526 CATCATTTCCTGGACAAGTAGGG + Intergenic
1054315708 9:63583628-63583650 CATCATTTCCTGGACAAGTAGGG - Intergenic
1054549883 9:66389948-66389970 CATCATTTCCTGGACAAGTAGGG + Intergenic
1055093953 9:72390905-72390927 CAGGCTTACATTCTCAAGTAAGG - Intergenic
1056279348 9:85025540-85025562 CAGGATTACCTGGTCAAGTATGG + Exonic
1189832448 X:44988781-44988803 CAGGAGTACCCGGTCATGTGAGG + Intronic
1191674498 X:63780194-63780216 CAGGCATACCTGGGCCAGTATGG - Intronic
1195128095 X:101828824-101828846 CAGCATTACCTGGTATATTAGGG + Intergenic
1195178074 X:102329766-102329788 CAGCATTACCTGGTATATTAGGG - Intergenic
1195180790 X:102357327-102357349 CAGCATTACCTGGTATATTAGGG + Intergenic
1196970606 X:121104295-121104317 AAGGAGTACCTGGCCTAGTAGGG + Intergenic
1199952411 X:152716367-152716389 CGGGAGGACCTGGTCACGTATGG + Intronic
1199957272 X:152752081-152752103 CGGGAGGACCTGGTCACGTATGG - Intronic
1201770304 Y:17612095-17612117 CAGGATTATCTGTTCAATGAGGG - Intergenic
1201831250 Y:18293892-18293914 CAGGATTATCTGTTCAATGAGGG + Intergenic
1202303722 Y:23445291-23445313 CATGATAACCAGGTCAAGAATGG - Intergenic
1202567088 Y:26225302-26225324 CATGATAACCAGGTCAAGAATGG + Intergenic