ID: 1056291363

View in Genome Browser
Species Human (GRCh38)
Location 9:85147228-85147250
Sequence TAATGCCTACACCCAGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056291363_1056291367 15 Left 1056291363 9:85147228-85147250 CCAGGCACTGGGTGTAGGCATTA No data
Right 1056291367 9:85147266-85147288 ACAAACAGATAAAACACTTATGG No data
1056291363_1056291365 -10 Left 1056291363 9:85147228-85147250 CCAGGCACTGGGTGTAGGCATTA No data
Right 1056291365 9:85147241-85147263 GTAGGCATTAGGTATACAACAGG No data
1056291363_1056291368 30 Left 1056291363 9:85147228-85147250 CCAGGCACTGGGTGTAGGCATTA No data
Right 1056291368 9:85147281-85147303 ACTTATGGAGTTTATAGTCTAGG No data
1056291363_1056291366 -9 Left 1056291363 9:85147228-85147250 CCAGGCACTGGGTGTAGGCATTA No data
Right 1056291366 9:85147242-85147264 TAGGCATTAGGTATACAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056291363 Original CRISPR TAATGCCTACACCCAGTGCC TGG (reversed) Intergenic
No off target data available for this crispr