ID: 1056294155

View in Genome Browser
Species Human (GRCh38)
Location 9:85174709-85174731
Sequence AACTTCATGTTCCACTACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056294155_1056294159 30 Left 1056294155 9:85174709-85174731 CCAGTGTAGTGGAACATGAAGTT No data
Right 1056294159 9:85174762-85174784 AGTTGTGATGTCATCTACTTCGG No data
1056294155_1056294156 -4 Left 1056294155 9:85174709-85174731 CCAGTGTAGTGGAACATGAAGTT No data
Right 1056294156 9:85174728-85174750 AGTTATATGCACTGAATTTTAGG No data
1056294155_1056294157 -3 Left 1056294155 9:85174709-85174731 CCAGTGTAGTGGAACATGAAGTT No data
Right 1056294157 9:85174729-85174751 GTTATATGCACTGAATTTTAGGG No data
1056294155_1056294158 5 Left 1056294155 9:85174709-85174731 CCAGTGTAGTGGAACATGAAGTT No data
Right 1056294158 9:85174737-85174759 CACTGAATTTTAGGGCTAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056294155 Original CRISPR AACTTCATGTTCCACTACAC TGG (reversed) Intergenic
No off target data available for this crispr