ID: 1056302713

View in Genome Browser
Species Human (GRCh38)
Location 9:85258445-85258467
Sequence CATGGCAAACAGAAGCAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056302713_1056302721 23 Left 1056302713 9:85258445-85258467 CCACCCTGCTTCTGTTTGCCATG No data
Right 1056302721 9:85258491-85258513 GCAGTCCCAATGAGATGAGCTGG 0: 6
1: 120
2: 370
3: 433
4: 356
1056302713_1056302722 24 Left 1056302713 9:85258445-85258467 CCACCCTGCTTCTGTTTGCCATG No data
Right 1056302722 9:85258492-85258514 CAGTCCCAATGAGATGAGCTGGG 0: 73
1: 372
2: 894
3: 933
4: 660

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056302713 Original CRISPR CATGGCAAACAGAAGCAGGG TGG (reversed) Intergenic
No off target data available for this crispr