ID: 1056303274

View in Genome Browser
Species Human (GRCh38)
Location 9:85263913-85263935
Sequence AAGCCTTTTAGCTATAATTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056303274_1056303276 4 Left 1056303274 9:85263913-85263935 CCATAATTATAGCTAAAAGGCTT No data
Right 1056303276 9:85263940-85263962 TTCACAAGGCTGTTTCAGACAGG No data
1056303274_1056303277 5 Left 1056303274 9:85263913-85263935 CCATAATTATAGCTAAAAGGCTT No data
Right 1056303277 9:85263941-85263963 TCACAAGGCTGTTTCAGACAGGG No data
1056303274_1056303275 -10 Left 1056303274 9:85263913-85263935 CCATAATTATAGCTAAAAGGCTT No data
Right 1056303275 9:85263926-85263948 TAAAAGGCTTAAACTTCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056303274 Original CRISPR AAGCCTTTTAGCTATAATTA TGG (reversed) Intergenic
No off target data available for this crispr