ID: 1056303277

View in Genome Browser
Species Human (GRCh38)
Location 9:85263941-85263963
Sequence TCACAAGGCTGTTTCAGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056303273_1056303277 6 Left 1056303273 9:85263912-85263934 CCCATAATTATAGCTAAAAGGCT No data
Right 1056303277 9:85263941-85263963 TCACAAGGCTGTTTCAGACAGGG No data
1056303271_1056303277 14 Left 1056303271 9:85263904-85263926 CCTTTCATCCCATAATTATAGCT No data
Right 1056303277 9:85263941-85263963 TCACAAGGCTGTTTCAGACAGGG No data
1056303274_1056303277 5 Left 1056303274 9:85263913-85263935 CCATAATTATAGCTAAAAGGCTT No data
Right 1056303277 9:85263941-85263963 TCACAAGGCTGTTTCAGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056303277 Original CRISPR TCACAAGGCTGTTTCAGACA GGG Intergenic
No off target data available for this crispr