ID: 1056304767

View in Genome Browser
Species Human (GRCh38)
Location 9:85279155-85279177
Sequence CTGTGGACACAATTTTGGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056304763_1056304767 18 Left 1056304763 9:85279114-85279136 CCAGTTTTTGTTTCTGTCACATA No data
Right 1056304767 9:85279155-85279177 CTGTGGACACAATTTTGGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056304767 Original CRISPR CTGTGGACACAATTTTGGCT AGG Intergenic
No off target data available for this crispr