ID: 1056305191

View in Genome Browser
Species Human (GRCh38)
Location 9:85283468-85283490
Sequence ATTCTGAAGCCAAATGAGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056305188_1056305191 10 Left 1056305188 9:85283435-85283457 CCATCTAAAACTGGATGCACAAA No data
Right 1056305191 9:85283468-85283490 ATTCTGAAGCCAAATGAGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056305191 Original CRISPR ATTCTGAAGCCAAATGAGGG CGG Intergenic
No off target data available for this crispr