ID: 1056307429

View in Genome Browser
Species Human (GRCh38)
Location 9:85303756-85303778
Sequence TCACTAGGAGTTAGGAGGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056307423_1056307429 -5 Left 1056307423 9:85303738-85303760 CCTTCTTGTTGACCTGGGTCACT No data
Right 1056307429 9:85303756-85303778 TCACTAGGAGTTAGGAGGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056307429 Original CRISPR TCACTAGGAGTTAGGAGGGC CGG Intergenic
No off target data available for this crispr