ID: 1056311109

View in Genome Browser
Species Human (GRCh38)
Location 9:85341877-85341899
Sequence CTGTGTTAAAGGAAGGTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056311109_1056311113 -7 Left 1056311109 9:85341877-85341899 CCATTCACCTTCCTTTAACACAG No data
Right 1056311113 9:85341893-85341915 AACACAGTGTAAGAAAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056311109 Original CRISPR CTGTGTTAAAGGAAGGTGAA TGG (reversed) Intergenic
No off target data available for this crispr