ID: 1056313922

View in Genome Browser
Species Human (GRCh38)
Location 9:85370415-85370437
Sequence GCTGCTAGCAAATATAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056313922_1056313924 6 Left 1056313922 9:85370415-85370437 CCTGCTTTATATTTGCTAGCAGC No data
Right 1056313924 9:85370444-85370466 GATGGTGCCCACCCAGAATAAGG No data
1056313922_1056313926 11 Left 1056313922 9:85370415-85370437 CCTGCTTTATATTTGCTAGCAGC No data
Right 1056313926 9:85370449-85370471 TGCCCACCCAGAATAAGGGTAGG No data
1056313922_1056313925 7 Left 1056313922 9:85370415-85370437 CCTGCTTTATATTTGCTAGCAGC No data
Right 1056313925 9:85370445-85370467 ATGGTGCCCACCCAGAATAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056313922 Original CRISPR GCTGCTAGCAAATATAAAGC AGG (reversed) Intergenic
No off target data available for this crispr