ID: 1056314237

View in Genome Browser
Species Human (GRCh38)
Location 9:85372975-85372997
Sequence AATTATCTGCTGAAGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056314235_1056314237 4 Left 1056314235 9:85372948-85372970 CCAAGAGCTGTCTCTGAAAAGAA No data
Right 1056314237 9:85372975-85372997 AATTATCTGCTGAAGATGGCAGG No data
1056314231_1056314237 25 Left 1056314231 9:85372927-85372949 CCACCAAAGCCCAGTAACAGGCC 0: 144
1: 161
2: 86
3: 68
4: 218
Right 1056314237 9:85372975-85372997 AATTATCTGCTGAAGATGGCAGG No data
1056314234_1056314237 15 Left 1056314234 9:85372937-85372959 CCAGTAACAGGCCAAGAGCTGTC 0: 162
1: 189
2: 129
3: 114
4: 178
Right 1056314237 9:85372975-85372997 AATTATCTGCTGAAGATGGCAGG No data
1056314233_1056314237 16 Left 1056314233 9:85372936-85372958 CCCAGTAACAGGCCAAGAGCTGT 0: 174
1: 194
2: 145
3: 123
4: 215
Right 1056314237 9:85372975-85372997 AATTATCTGCTGAAGATGGCAGG No data
1056314232_1056314237 22 Left 1056314232 9:85372930-85372952 CCAAAGCCCAGTAACAGGCCAAG 0: 169
1: 171
2: 103
3: 76
4: 232
Right 1056314237 9:85372975-85372997 AATTATCTGCTGAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056314237 Original CRISPR AATTATCTGCTGAAGATGGC AGG Intergenic
No off target data available for this crispr