ID: 1056319049 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:85419502-85419524 |
| Sequence | ATGAAAGATTGGTGGGAAAT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1056319049_1056319055 | 2 | Left | 1056319049 | 9:85419502-85419524 | CCAATTTCCCACCAATCTTTCAT | No data | ||
| Right | 1056319055 | 9:85419527-85419549 | CATGCTGATCAGCAGGCCCCAGG | No data | ||||
| 1056319049_1056319053 | -5 | Left | 1056319049 | 9:85419502-85419524 | CCAATTTCCCACCAATCTTTCAT | No data | ||
| Right | 1056319053 | 9:85419520-85419542 | TTCATACCATGCTGATCAGCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1056319049 | Original CRISPR | ATGAAAGATTGGTGGGAAAT TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||