ID: 1056319049

View in Genome Browser
Species Human (GRCh38)
Location 9:85419502-85419524
Sequence ATGAAAGATTGGTGGGAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056319049_1056319055 2 Left 1056319049 9:85419502-85419524 CCAATTTCCCACCAATCTTTCAT No data
Right 1056319055 9:85419527-85419549 CATGCTGATCAGCAGGCCCCAGG No data
1056319049_1056319053 -5 Left 1056319049 9:85419502-85419524 CCAATTTCCCACCAATCTTTCAT No data
Right 1056319053 9:85419520-85419542 TTCATACCATGCTGATCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056319049 Original CRISPR ATGAAAGATTGGTGGGAAAT TGG (reversed) Intergenic
No off target data available for this crispr