ID: 1056319505

View in Genome Browser
Species Human (GRCh38)
Location 9:85423105-85423127
Sequence TAGGACCCACAAGCTGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056319505_1056319506 -6 Left 1056319505 9:85423105-85423127 CCATTCTCAGCTTGTGGGTCCTA No data
Right 1056319506 9:85423122-85423144 GTCCTACAGAAACATACTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056319505 Original CRISPR TAGGACCCACAAGCTGAGAA TGG (reversed) Intergenic
No off target data available for this crispr