ID: 1056321751

View in Genome Browser
Species Human (GRCh38)
Location 9:85441740-85441762
Sequence CAGAATTGTCTTAATTAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056321751_1056321755 19 Left 1056321751 9:85441740-85441762 CCACTCTAATTAAGACAATTCTG No data
Right 1056321755 9:85441782-85441804 CTGCTTACATCAGCCAGAGATGG No data
1056321751_1056321757 28 Left 1056321751 9:85441740-85441762 CCACTCTAATTAAGACAATTCTG No data
Right 1056321757 9:85441791-85441813 TCAGCCAGAGATGGCTTCTAGGG No data
1056321751_1056321756 27 Left 1056321751 9:85441740-85441762 CCACTCTAATTAAGACAATTCTG No data
Right 1056321756 9:85441790-85441812 ATCAGCCAGAGATGGCTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056321751 Original CRISPR CAGAATTGTCTTAATTAGAG TGG (reversed) Intergenic
No off target data available for this crispr