ID: 1056324902

View in Genome Browser
Species Human (GRCh38)
Location 9:85469121-85469143
Sequence AGCCCATGGCGTAATTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056324902_1056324908 28 Left 1056324902 9:85469121-85469143 CCAGCACAATTACGCCATGGGCT No data
Right 1056324908 9:85469172-85469194 AGGCCCCAGCAGCTCATCGGCGG No data
1056324902_1056324909 29 Left 1056324902 9:85469121-85469143 CCAGCACAATTACGCCATGGGCT No data
Right 1056324909 9:85469173-85469195 GGCCCCAGCAGCTCATCGGCGGG No data
1056324902_1056324907 25 Left 1056324902 9:85469121-85469143 CCAGCACAATTACGCCATGGGCT No data
Right 1056324907 9:85469169-85469191 CACAGGCCCCAGCAGCTCATCGG No data
1056324902_1056324904 8 Left 1056324902 9:85469121-85469143 CCAGCACAATTACGCCATGGGCT No data
Right 1056324904 9:85469152-85469174 GCCATGAAAAATGATGCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056324902 Original CRISPR AGCCCATGGCGTAATTGTGC TGG (reversed) Intergenic
No off target data available for this crispr