ID: 1056324964

View in Genome Browser
Species Human (GRCh38)
Location 9:85469575-85469597
Sequence GGGTCCTTGTATCTCCCTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056324962_1056324964 -9 Left 1056324962 9:85469561-85469583 CCAAGTCTTCTCCGGGGTCCTTG No data
Right 1056324964 9:85469575-85469597 GGGTCCTTGTATCTCCCTATTGG No data
1056324958_1056324964 22 Left 1056324958 9:85469530-85469552 CCGGGTCTGATCATGAGTGTCAT No data
Right 1056324964 9:85469575-85469597 GGGTCCTTGTATCTCCCTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056324964 Original CRISPR GGGTCCTTGTATCTCCCTAT TGG Intergenic
No off target data available for this crispr