ID: 1056326796

View in Genome Browser
Species Human (GRCh38)
Location 9:85486807-85486829
Sequence TTTCTGATGTGGCAGCAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056326792_1056326796 26 Left 1056326792 9:85486758-85486780 CCTTTAGGGTGCTACATGCTGAC No data
Right 1056326796 9:85486807-85486829 TTTCTGATGTGGCAGCAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056326796 Original CRISPR TTTCTGATGTGGCAGCAACC TGG Intergenic
No off target data available for this crispr