ID: 1056331666

View in Genome Browser
Species Human (GRCh38)
Location 9:85526174-85526196
Sequence GACCCAATGCTCCCTCTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056331663_1056331666 -10 Left 1056331663 9:85526161-85526183 CCAACCCAAAGCTGACCCAATGC No data
Right 1056331666 9:85526174-85526196 GACCCAATGCTCCCTCTGACTGG No data
1056331658_1056331666 5 Left 1056331658 9:85526146-85526168 CCCTTCACACCTACCCCAACCCA No data
Right 1056331666 9:85526174-85526196 GACCCAATGCTCCCTCTGACTGG No data
1056331657_1056331666 6 Left 1056331657 9:85526145-85526167 CCCCTTCACACCTACCCCAACCC No data
Right 1056331666 9:85526174-85526196 GACCCAATGCTCCCTCTGACTGG No data
1056331660_1056331666 -4 Left 1056331660 9:85526155-85526177 CCTACCCCAACCCAAAGCTGACC No data
Right 1056331666 9:85526174-85526196 GACCCAATGCTCCCTCTGACTGG No data
1056331655_1056331666 13 Left 1056331655 9:85526138-85526160 CCATCCACCCCTTCACACCTACC No data
Right 1056331666 9:85526174-85526196 GACCCAATGCTCCCTCTGACTGG No data
1056331661_1056331666 -8 Left 1056331661 9:85526159-85526181 CCCCAACCCAAAGCTGACCCAAT No data
Right 1056331666 9:85526174-85526196 GACCCAATGCTCCCTCTGACTGG No data
1056331662_1056331666 -9 Left 1056331662 9:85526160-85526182 CCCAACCCAAAGCTGACCCAATG No data
Right 1056331666 9:85526174-85526196 GACCCAATGCTCCCTCTGACTGG No data
1056331659_1056331666 4 Left 1056331659 9:85526147-85526169 CCTTCACACCTACCCCAACCCAA No data
Right 1056331666 9:85526174-85526196 GACCCAATGCTCCCTCTGACTGG No data
1056331656_1056331666 9 Left 1056331656 9:85526142-85526164 CCACCCCTTCACACCTACCCCAA No data
Right 1056331666 9:85526174-85526196 GACCCAATGCTCCCTCTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056331666 Original CRISPR GACCCAATGCTCCCTCTGAC TGG Intergenic
No off target data available for this crispr