ID: 1056336991

View in Genome Browser
Species Human (GRCh38)
Location 9:85581564-85581586
Sequence GAGTATCCCTGATTCTTAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 88}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056336991 Original CRISPR GAGTATCCCTGATTCTTAGT AGG (reversed) Intronic
901665678 1:10824897-10824919 GAGGGTCCCTGATGCTTAGAGGG - Intergenic
903942706 1:26942638-26942660 GAGTGTCCCTGATTGTAAGCAGG + Exonic
905465154 1:38147664-38147686 GAAGATCCCTGAATTTTAGTCGG - Intergenic
907440051 1:54473364-54473386 GCATATTCCTGATTCTTAGGAGG + Intergenic
910831169 1:91463851-91463873 GAAGATCCCTGAATTTTAGTCGG + Intergenic
913933984 1:125015623-125015645 GAGTATCGCTGATTGCTAGCAGG + Intergenic
918476758 1:184933478-184933500 CACTATCCCTGATTCATAGTAGG - Intronic
919062845 1:192655985-192656007 AAGTATCCCTGTTTCTTTTTTGG - Intronic
1063240327 10:4162890-4162912 AAGGAACCCTGATTCTGAGTGGG - Intergenic
1063736071 10:8756698-8756720 GACTGACCCTTATTCTTAGTAGG + Intergenic
1064766798 10:18683408-18683430 GAGTATACATATTTCTTAGTAGG - Intergenic
1065745673 10:28839420-28839442 CAGTGTCCCTTATTCTTTGTGGG + Intergenic
1068589439 10:58838642-58838664 GAGAATTTCTGATTATTAGTAGG - Intergenic
1069540790 10:69292450-69292472 GATTACCCCTGATTCTTACAGGG + Intronic
1069881062 10:71593701-71593723 GCGTTCCCCTGATTTTTAGTCGG - Intronic
1082671631 11:56042595-56042617 GAAGATCCCTGAATTTTAGTTGG - Intergenic
1085842661 11:80030435-80030457 GAGCATCCCTGAGTCTTTATGGG + Intergenic
1089132674 11:116224599-116224621 GATTATCCCTGAGTCTTGGCTGG + Intergenic
1089806566 11:121095905-121095927 TAGCATCCCTGAATCTTTGTAGG + Intergenic
1097484944 12:60185032-60185054 GAGTATCTCTCTTTCTTACTAGG + Intergenic
1103052708 12:117795039-117795061 GAGTGCCCCTAATTCTAAGTTGG + Intronic
1103231353 12:119333543-119333565 GAGAATGCCTGATTCTTCCTCGG + Intergenic
1107441194 13:40428814-40428836 GGGTATCCCAGCTTCTAAGTGGG + Intergenic
1114841246 14:26264866-26264888 CGGTATCCCTGATTCTTCATAGG - Intergenic
1117634064 14:57723917-57723939 GAAGATCCCTGAATTTTAGTTGG - Intronic
1125431021 15:39593555-39593577 GAGTATCCCTGAGCCCTCGTGGG - Exonic
1125648394 15:41292745-41292767 GATTAACCCTGATTCATTGTTGG + Intergenic
1129832308 15:78679046-78679068 GAGGATCCCTGATTCTCTTTAGG + Intronic
1135842508 16:25889532-25889554 TGGTATTCTTGATTCTTAGTGGG + Intronic
1139199488 16:64958857-64958879 GAGTACCCCTGATTGTTTGTGGG - Intronic
1139609955 16:68048853-68048875 GAGATTCTCTAATTCTTAGTTGG - Intronic
1153539257 18:6136296-6136318 GAGTCACCCTGATTCTTCCTTGG - Intronic
1156839160 18:41590931-41590953 GAGTATCTCTGGGTCTTAGCTGG - Intergenic
1159559173 18:69975816-69975838 GAAGATCCCTGAATTTTAGTCGG + Intergenic
1163265571 19:16218627-16218649 CAGTGTCCCTGTCTCTTAGTGGG + Intronic
1164944964 19:32285759-32285781 GAGCATCCCTGCTTCGTTGTGGG - Intergenic
1165001592 19:32767828-32767850 CAGAACCCCTGATTTTTAGTGGG - Intronic
1167949668 19:53016047-53016069 AAGTATACATGCTTCTTAGTGGG - Exonic
1168647451 19:58069250-58069272 GAGTCTCACTGATTCTGAGATGG + Exonic
931881084 2:66571631-66571653 GAGCATCCCTAATTCTTCATAGG + Exonic
936641163 2:114314228-114314250 GAAGATCCCTGAATTTTAGTCGG - Intergenic
939517127 2:143182824-143182846 TAGTATCCCTGCTACTTAGTAGG - Intronic
939633423 2:144552248-144552270 GAATGTCCCTGATTTTTAATTGG + Intergenic
942614473 2:177775965-177775987 GAGTATGGTTGATACTTAGTTGG + Intronic
942843972 2:180400676-180400698 TAGTGTCCCTTATTCTTAGACGG - Intergenic
944472355 2:200067511-200067533 GAATATCCCTGTTTTTTAATTGG - Intergenic
944903260 2:204237354-204237376 GAGTATGCCTGATTGTTTGAAGG + Intergenic
945149082 2:206768901-206768923 GAATATCCCTGTTTATTTGTAGG + Intronic
945372957 2:209043547-209043569 GATTATCCTGGATTCTGAGTGGG - Intergenic
1169691407 20:8336410-8336432 GAGTATCTAGGATTCTCAGTGGG + Intronic
1180657769 22:17437771-17437793 GAGCATCACTGCTTCTTAGCAGG + Intronic
1182596259 22:31423130-31423152 GAGTGTCACTGACTTTTAGTAGG - Intronic
1183465787 22:37979834-37979856 GAGAATCCATGAGTCTTTGTGGG + Intronic
951823403 3:26839701-26839723 GAGTAGCCCTGTATCTCAGTGGG - Intergenic
959811595 3:110626552-110626574 GAGTATCCATTTGTCTTAGTCGG - Intergenic
960161967 3:114360303-114360325 GAGTATCTCTGTTTGTTGGTAGG + Intronic
960378617 3:116932980-116933002 GTATATGCCTGATTCTTTGTGGG - Intronic
964076307 3:152696778-152696800 TAGAATCCCTGATTTTTAGCTGG + Intergenic
964522279 3:157582218-157582240 GAGTATCCTTTTTTCTTAGAAGG + Intronic
972117382 4:35653751-35653773 AATTATCCCTGCATCTTAGTTGG - Intergenic
974404840 4:61452410-61452432 CAGATTCCCTGATTCTGAGTTGG - Intronic
977331244 4:95640375-95640397 GAGTATACCTGAGTCTGAATGGG + Intergenic
978341660 4:107726012-107726034 GAAGATCCCTGAATTTTAGTTGG + Intergenic
987236148 5:15943795-15943817 GAGTCTCCCAGAATCTGAGTAGG + Intergenic
989741863 5:44783141-44783163 GAGTATCCCTGTTTATTTTTTGG - Intergenic
990712345 5:58599167-58599189 GAGCATTCCACATTCTTAGTGGG - Intronic
992314606 5:75539583-75539605 GAGTATCTCTGAAGCCTAGTAGG - Intronic
992428541 5:76684470-76684492 GAATATCCTTGATTCTTTGATGG - Intronic
993661653 5:90645099-90645121 CAGTATCAGGGATTCTTAGTTGG + Intronic
994291436 5:98032412-98032434 GAACATCCCTGAATTTTAGTCGG + Intergenic
1000536296 5:162482511-162482533 GAGTAGCAGGGATTCTTAGTGGG + Intergenic
1000669860 5:164047487-164047509 GAGTTTCCCTGATTTTAATTAGG - Intergenic
1005320045 6:24644257-24644279 GAGTCTCCCTGGTTCAGAGTGGG - Intronic
1005986711 6:30880564-30880586 CAGAATCCCAGTTTCTTAGTTGG - Intronic
1012921613 6:105225849-105225871 GAGGATCCCTAATTAGTAGTGGG + Intergenic
1014631582 6:123796339-123796361 GAAGATCCCTGAATTTTAGTCGG - Intergenic
1015752859 6:136578361-136578383 GCGGATCCCTGATTCATATTTGG - Intronic
1018538286 6:164847990-164848012 GAGTTGTCCTGATTCTCAGTGGG + Intergenic
1025102117 7:56144045-56144067 GAGAATCCCTGATTGATAATTGG + Intergenic
1026317166 7:69237427-69237449 GAGAACCCCTGATTGATAGTTGG - Intergenic
1049069892 8:140348250-140348272 GACTATCACTGAAACTTAGTTGG - Intronic
1051025342 9:12603774-12603796 GAGGATTCCTGATTCCCAGTGGG + Intergenic
1056007253 9:82285587-82285609 GGGTATCCCTGCTGCTTATTTGG - Intergenic
1056336991 9:85581564-85581586 GAGTATCCCTGATTCTTAGTAGG - Intronic
1056654499 9:88497955-88497977 GAATATCACTGATACTCAGTGGG - Intergenic
1057565825 9:96165292-96165314 CAGTTTCCCAGATTCTTTGTTGG - Intergenic
1058194475 9:101955928-101955950 TAGTATTCCTGATTCTTATGTGG - Intergenic
1058959197 9:109977061-109977083 GAGAATCTCTGATTCTAAGGTGG - Intronic
1059049711 9:110910674-110910696 GAACATCCATGATTCATAGTAGG + Intronic
1186622296 X:11254113-11254135 TAAAATCCCTGATTCTGAGTTGG + Intronic
1189283546 X:39836117-39836139 TAGAACCCCTGATTTTTAGTTGG - Intergenic
1199457681 X:148047392-148047414 AAACAACCCTGATTCTTAGTTGG - Intergenic