ID: 1056338839

View in Genome Browser
Species Human (GRCh38)
Location 9:85603677-85603699
Sequence CCCCTAGGGTCCCCAATTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056338832_1056338839 3 Left 1056338832 9:85603651-85603673 CCAGCTTGACAACAGTACCAAGA 0: 1
1: 0
2: 0
3: 6
4: 131
Right 1056338839 9:85603677-85603699 CCCCTAGGGTCCCCAATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056338839 Original CRISPR CCCCTAGGGTCCCCAATTTC AGG Intronic
No off target data available for this crispr