ID: 1056339223

View in Genome Browser
Species Human (GRCh38)
Location 9:85608431-85608453
Sequence ACCAAATGACATAATCAATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056339222_1056339223 28 Left 1056339222 9:85608380-85608402 CCACTCTCAGAATAAGATAGAAC 0: 1
1: 0
2: 1
3: 25
4: 391
Right 1056339223 9:85608431-85608453 ACCAAATGACATAATCAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056339223 Original CRISPR ACCAAATGACATAATCAATG TGG Intronic
No off target data available for this crispr