ID: 1056339368

View in Genome Browser
Species Human (GRCh38)
Location 9:85610031-85610053
Sequence GGGACTAATCCATTCTAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056339360_1056339368 13 Left 1056339360 9:85609995-85610017 CCAAAAGGCAAAAATGTATGAGG 0: 1
1: 0
2: 1
3: 26
4: 238
Right 1056339368 9:85610031-85610053 GGGACTAATCCATTCTAGGGAGG No data
1056339359_1056339368 14 Left 1056339359 9:85609994-85610016 CCCAAAAGGCAAAAATGTATGAG 0: 1
1: 2
2: 4
3: 39
4: 362
Right 1056339368 9:85610031-85610053 GGGACTAATCCATTCTAGGGAGG No data
1056339358_1056339368 15 Left 1056339358 9:85609993-85610015 CCCCAAAAGGCAAAAATGTATGA 0: 1
1: 0
2: 3
3: 43
4: 439
Right 1056339368 9:85610031-85610053 GGGACTAATCCATTCTAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056339368 Original CRISPR GGGACTAATCCATTCTAGGG AGG Intronic
No off target data available for this crispr