ID: 1056339763

View in Genome Browser
Species Human (GRCh38)
Location 9:85615262-85615284
Sequence TTGCTGAAGACTAGGGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 308}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056339763_1056339766 14 Left 1056339763 9:85615262-85615284 CCATTTTCCCTAGTCTTCAGCAA 0: 1
1: 0
2: 1
3: 25
4: 308
Right 1056339766 9:85615299-85615321 CTTTGAGAAATCCAACTTCTAGG No data
1056339763_1056339767 23 Left 1056339763 9:85615262-85615284 CCATTTTCCCTAGTCTTCAGCAA 0: 1
1: 0
2: 1
3: 25
4: 308
Right 1056339767 9:85615308-85615330 ATCCAACTTCTAGGAATTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056339763 Original CRISPR TTGCTGAAGACTAGGGAAAA TGG (reversed) Intronic
900920920 1:5669885-5669907 TTGATGAAGACGAGTGAAGACGG + Intergenic
902036379 1:13461150-13461172 TTGCTGGTGACAATGGAAAATGG + Intergenic
902367114 1:15983290-15983312 GAGCTGAAGCCTAGGGAATATGG + Intergenic
904272985 1:29362580-29362602 TTGCTGGAGAAGAGGGAAAAAGG + Intergenic
904424550 1:30415050-30415072 TTGCTGGAGAAGAAGGAAAAGGG - Intergenic
905509627 1:38508579-38508601 TTGCTGGAGACAAGGGAAATTGG + Intergenic
906333166 1:44904950-44904972 TTTCTCAGAACTAGGGAAAAGGG + Intronic
906849027 1:49227824-49227846 TGGCTGAAGATTAGAGAATAGGG - Intronic
908085776 1:60632309-60632331 CTGCTGAAAACAAAGGAAAATGG - Intergenic
910354524 1:86340397-86340419 TTGCTGACGACTGGAGAAATGGG + Intergenic
910473571 1:87581314-87581336 TTGCTGATGAGAAGGTAAAATGG - Intergenic
911082217 1:93944317-93944339 TTGCTTAAGACTAGGGAATTGGG - Intergenic
911208052 1:95112496-95112518 TTTCAGACTACTAGGGAAAATGG + Intergenic
912111038 1:106343993-106344015 TTGCTGATGTCTATAGAAAAAGG - Intergenic
912365918 1:109133867-109133889 TTCCTGAAAATTAGGGAGAATGG + Intronic
912875277 1:113351567-113351589 TTTCTGAAGAGCAGGGAGAAAGG - Intergenic
913393004 1:118335066-118335088 GGGCTGAAGCCTTGGGAAAAGGG + Intergenic
915752070 1:158221070-158221092 CTGCTGATACCTAGGGAAAAAGG - Intergenic
916941860 1:169685479-169685501 TTTATGAAGACAAGGGAAACAGG - Intronic
917281940 1:173386019-173386041 TTCATCAAGACAAGGGAAAAAGG + Intergenic
917912865 1:179669174-179669196 TTGCTGCAGAATGGGAAAAATGG - Exonic
918945175 1:191054485-191054507 TTAATGAAGATTAGTGAAAATGG - Intergenic
919511273 1:198467746-198467768 TTGAGGAAGACTAGGGAAAGAGG + Intergenic
919866529 1:201787113-201787135 TTCCTAAAGCCTAGGGAGAAAGG + Intronic
921448185 1:215271159-215271181 TTCATGAAGACTAGGGCACATGG - Intergenic
921890675 1:220350708-220350730 TTGTTAAAGGCTTGGGAAAAGGG - Intergenic
922082577 1:222311276-222311298 TGCCTGAAGACCAGGAAAAAGGG - Intergenic
922164843 1:223107062-223107084 GTGATAAAGACTTGGGAAAATGG + Intergenic
922636593 1:227179157-227179179 TTGCTTAAGGCTGGGGAAATAGG + Intronic
923300807 1:232638856-232638878 TTGCTGAAGAATAGGGAGCAAGG - Intergenic
924046578 1:240038081-240038103 TTGCTAAAGGCTACTGAAAATGG - Intronic
924163071 1:241253761-241253783 TAGTTGAATACCAGGGAAAAGGG - Intronic
1064215956 10:13400818-13400840 TTGATAAAGAAAAGGGAAAAGGG + Intergenic
1064376240 10:14798989-14799011 TTGCTGGAGACTGGGGAGAGAGG + Intergenic
1064957774 10:20930443-20930465 TGGCTGATGTCTAGGAAAAATGG - Intronic
1065700334 10:28419211-28419233 TGGCAGAAGACCAGGGAAACAGG - Intergenic
1067024705 10:42834476-42834498 TTGCTGAAGACTCTGAATAATGG - Exonic
1067936554 10:50617400-50617422 TTGCTTAAGTCTGGGGACAAAGG + Intronic
1068020974 10:51583633-51583655 TCACTGAAGACTAAGGTAAATGG - Intronic
1068409424 10:56635624-56635646 ATGATGATGACCAGGGAAAAGGG + Intergenic
1070255491 10:74810110-74810132 TTGCGGAAGGCTGGGGAAACAGG + Intergenic
1070530840 10:77335896-77335918 TTGATGAAGAGGAGGGACAAGGG - Intronic
1070705928 10:78638636-78638658 TTGCTGAGGACAAAGGAAATGGG - Intergenic
1071778296 10:88813820-88813842 TTGCTGCAGCCTTGTGAAAAGGG - Intronic
1072204201 10:93188086-93188108 TTGGTGATAACTAGGGAAAGGGG - Intergenic
1072900881 10:99405652-99405674 TTGCTGAGGAATTAGGAAAATGG - Intronic
1073347874 10:102798285-102798307 TAGCTGAAGACTAGAGAATATGG + Intronic
1073712023 10:106054263-106054285 TGTCTGAAGATAAGGGAAAATGG - Intergenic
1074299580 10:112221407-112221429 TTCCTGAAGACTAGTGATACAGG - Intergenic
1077511288 11:2964952-2964974 TTGCTCCACACTAGGGAAAGGGG - Intronic
1078284444 11:9937236-9937258 TTTCTGAAGACTGGGGTCAAAGG + Intronic
1078831012 11:14976861-14976883 TTGCTGAAGACTTTAGAAGAGGG + Intronic
1079444055 11:20543841-20543863 TTGCCGAAGGCTTGGGAAGAAGG + Intergenic
1079585336 11:22119713-22119735 TTGGTGAAGCCTAGGAAAGAAGG - Intergenic
1080498286 11:32843796-32843818 TTGCTAAAGCCTAGGGAGAGGGG - Intronic
1081030795 11:38080060-38080082 TTGCTTAACACTAGGGAATGTGG + Intergenic
1081719503 11:45277576-45277598 TGGCTGAAGAGTAGAGAGAAAGG - Intronic
1082014979 11:47478617-47478639 TTGAAGAAGAATATGGAAAAGGG - Intronic
1085485437 11:76859813-76859835 TAGCTGAACACTAGGGGCAAGGG + Intergenic
1085702868 11:78760717-78760739 TTCCTGAAGACTAGAGAGAAAGG - Intronic
1087370239 11:97274361-97274383 TTGCTGGAGACTAGGGCACTGGG - Intergenic
1091622880 12:2102505-2102527 TTGCTGATGTCTGGGGAGAAGGG - Intronic
1091657836 12:2358779-2358801 TTGCTGGAAACTTGGGAAAGTGG - Intronic
1091701324 12:2665285-2665307 TTGCTGAGGAGTGAGGAAAAGGG + Intronic
1092565830 12:9664438-9664460 TTCCTCAAGACTAGGAGAAAGGG - Intergenic
1093061281 12:14608935-14608957 TTTCTTAAGACAAGTGAAAATGG - Intergenic
1093126669 12:15337876-15337898 TTGCCAAAGACTAGGGATTAGGG + Intronic
1093538901 12:20256700-20256722 TTGCTGATGAGAATGGAAAATGG - Intergenic
1093702353 12:22236254-22236276 TTGCTGAATTCTAGGGATCAGGG - Intronic
1093797617 12:23331893-23331915 TTGCTGTAGGCTTGTGAAAAAGG + Intergenic
1094353799 12:29556172-29556194 TTACTGAAGACTACAGTAAAGGG - Intronic
1094551843 12:31459759-31459781 TTGCAGCAAACTAGGGATAATGG - Intronic
1095366176 12:41408616-41408638 CTGCTGAAGACTTTGGAAATCGG + Intronic
1096011198 12:48216917-48216939 TTGCTGAAGAAAAGGGAAATGGG + Intergenic
1096274363 12:50193075-50193097 TGGATGAAGATTATGGAAAAGGG + Intronic
1097400420 12:59121929-59121951 GAGAGGAAGACTAGGGAAAAGGG - Intergenic
1097909407 12:64953302-64953324 TTGCTGAAGAATAGAGGACAGGG - Intergenic
1100088460 12:90939467-90939489 ATGGTGAAGAGTTGGGAAAAAGG + Intronic
1100796841 12:98191242-98191264 TTGCTGAACACTAAGAAAATCGG + Intergenic
1100833226 12:98538898-98538920 ATGCTGAAGAATAAGGAAATAGG + Intronic
1101178075 12:102177838-102177860 TGGCTGAAGAATAAGGTAAAAGG - Intronic
1102828747 12:115975125-115975147 TTGCAGAAGACAGAGGAAAAGGG - Intronic
1106626060 13:31422106-31422128 TTGCTGAAGAGTGAGGAAATGGG - Intergenic
1106775612 13:33005926-33005948 TTTTTTAAGACTGGGGAAAATGG - Intergenic
1107525398 13:41225992-41226014 CTGATGGAGACTAGGGACAAGGG - Intronic
1107762289 13:43692774-43692796 TTATTGAAGACGTGGGAAAATGG + Intronic
1108113315 13:47101273-47101295 TTCCTGGAGACAAAGGAAAAGGG + Intergenic
1108668061 13:52652454-52652476 ATGATAAAAACTAGGGAAAATGG + Intergenic
1108745949 13:53393937-53393959 TTGCTGAAGATGAGTGAAATTGG + Intergenic
1109978793 13:69877665-69877687 TTGCTATAGACCAGAGAAAAAGG - Intronic
1110414536 13:75237506-75237528 TTATTGAAGACTAAGTAAAAAGG + Intergenic
1110998758 13:82149985-82150007 TTTCTGAGGACTGGGGAAAGAGG - Intergenic
1111226473 13:85279100-85279122 TTGCTGAAGATTTAGGGAAATGG + Intergenic
1111461312 13:88546049-88546071 TTGTTGATGGCTAGGGAAAGAGG + Intergenic
1111949950 13:94702438-94702460 TTGCTCAACACTTGGGAAATGGG + Intergenic
1115724631 14:36199518-36199540 TTGCTAAAAACTGGGGAAGATGG + Intergenic
1116487109 14:45463214-45463236 TTGCTACATACTAGGAAAAATGG + Intergenic
1117440769 14:55757022-55757044 CTGGTGAGGACTAGGGAAAATGG + Intergenic
1117538202 14:56721635-56721657 TTGCTGGATTCTAGGGAACATGG - Intronic
1118543974 14:66864321-66864343 CTGGTGAGGACTAGAGAAAAGGG + Intronic
1119769268 14:77210342-77210364 TTGCTTAAGGCTGGGGAAAGTGG - Intronic
1120331373 14:83096931-83096953 TTGCTAAAGAGTAATGAAAATGG + Intergenic
1120434121 14:84458233-84458255 TACATGAAGACTAGGCAAAAGGG + Intergenic
1120614307 14:86683823-86683845 CTGCTGAAGGATATGGAAAATGG + Intergenic
1122526292 14:102387470-102387492 TTGTTGAATGCTAAGGAAAAGGG - Intronic
1122944442 14:104999962-104999984 TGGCAGAACACTAGGAAAAAGGG + Intronic
1124647533 15:31449512-31449534 TGGCTGAACACTTTGGAAAATGG + Intergenic
1125134162 15:36322426-36322448 TTTCTGAAGTCTAGAGAAGATGG - Intergenic
1127436281 15:58961408-58961430 TTGCTGAGGAGTATGCAAAATGG - Intronic
1128919621 15:71598478-71598500 TGACTGAAGACTGGGGAGAAGGG + Intronic
1129502140 15:76049500-76049522 TTGTTGATGAATAGGGAAGAAGG - Intronic
1130110234 15:80958110-80958132 TTGCTGAAGATTTAGGAATATGG + Intronic
1130391965 15:83464670-83464692 TTGCTGATGAATTGGGAATAAGG - Intronic
1133841616 16:9415307-9415329 TGGCTGAAGCCTGGGGAACATGG + Intergenic
1134556507 16:15170285-15170307 TTTAGGAAGACTAGGTAAAACGG - Intergenic
1134917085 16:18081998-18082020 TTTAGGAAGACTAGGTAAAACGG - Intergenic
1135170445 16:20178984-20179006 TTGAGGAAGACAAGGGATAAGGG - Intergenic
1135388479 16:22067266-22067288 TTCCTGAAGAAGAGAGAAAAAGG + Intronic
1136082589 16:27861867-27861889 TTTCTGAAGCCCAGGGAATATGG - Intronic
1136858968 16:33683923-33683945 TTGCTGAAGACTCTGAATAATGG + Intergenic
1137914751 16:52417160-52417182 TTGCTGAAAACCAGTGATAAAGG - Intergenic
1138774474 16:59704818-59704840 TTGGTGAGGACTGGAGAAAAGGG - Intergenic
1141215205 16:82017409-82017431 TTGCTGAAAACTAGGGGATTTGG + Intergenic
1141552581 16:84816018-84816040 TTCCAGAAGACTTGGAAAAATGG - Intergenic
1203120481 16_KI270728v1_random:1532102-1532124 TTGCTGAAGACTCTGAATAATGG + Intergenic
1143180069 17:4979170-4979192 TTGCTGAGGACTCTGGAAACAGG + Intronic
1146128135 17:30245331-30245353 CTGCTAAAGATTAGGGAAATGGG - Intergenic
1146276799 17:31521456-31521478 TAGCTGAGGACAAAGGAAAAGGG - Intronic
1147042079 17:37726997-37727019 TTGCTGCCGACTAGAGCAAAGGG + Intronic
1149254706 17:54812706-54812728 TTGCTAAAGACCGGGAAAAAAGG - Intergenic
1151757491 17:76083067-76083089 GTGCTGGACTCTAGGGAAAATGG + Exonic
1152039620 17:77894440-77894462 TTGCTGGGGACAAGGCAAAAGGG + Intergenic
1153292922 18:3519469-3519491 TTGTTGAAGATGAGGGAATAGGG - Intronic
1153294823 18:3535404-3535426 TTGCTTAGAAATAGGGAAAAAGG + Intronic
1154987347 18:21565386-21565408 TTCTAGAAGTCTAGGGAAAAGGG + Intronic
1155168593 18:23250373-23250395 GTGCTGATGACTTGGGAAACAGG + Intronic
1156593744 18:38521857-38521879 TTTCTGAATACACGGGAAAAAGG - Intergenic
1156837591 18:41574152-41574174 TTGCTGAAGAGCAGAGTAAAAGG + Intergenic
1158045927 18:53155303-53155325 TTGATAAAGACTAGGGAAAATGG + Intronic
1158092308 18:53728414-53728436 TTGCTGAAGAAGAAGGAAGAGGG + Intergenic
1159201799 18:65195942-65195964 TTGTTGTAGATTAGGGAAGATGG - Intergenic
1159726439 18:71966278-71966300 TTCCTAAGGACTGGGGAAAATGG + Intergenic
1159768297 18:72517420-72517442 CAGCTGTAGACTAGAGAAAATGG + Intergenic
1160829093 19:1094636-1094658 TCGCTGAGGACAAGGGCAAAGGG + Intronic
1162312762 19:9916900-9916922 TCTCTGAAGTCAAGGGAAAAAGG - Intronic
1162820025 19:13217280-13217302 TTGCTGGAGACTGGGAGAAAGGG - Intronic
1165168627 19:33874526-33874548 ATGCAGAAAAATAGGGAAAAGGG + Intergenic
1165658531 19:37554529-37554551 TTGCTGAAAACTAGTGGTAAAGG - Intronic
1165677098 19:37735808-37735830 TTACTGGAGACTAGGGGGAAGGG + Intergenic
1167582415 19:50353565-50353587 TTTCTGAAGTCCAGGGAATATGG - Intronic
925830255 2:7886941-7886963 GTGCTGAGGACTATGGAAAGAGG - Intergenic
926269251 2:11352797-11352819 TGAGTGATGACTAGGGAAAAGGG + Intergenic
927517976 2:23682975-23682997 CTGCTGAAGACCAAGGAAGACGG - Intronic
927985559 2:27408329-27408351 ATTCTGAAGTCTAGGCAAAAGGG - Intronic
929320101 2:40532586-40532608 TCGCTGAAGCCTAGGGTAATGGG + Intronic
932286592 2:70538969-70538991 TTGCTGAAGGTTAGGGTAACTGG - Intronic
932664642 2:73687019-73687041 TTGCTGAAGACCAGGGAGAGAGG - Intergenic
933150667 2:78911090-78911112 TTGAAGAGGACTAGGGGAAATGG + Intergenic
933742005 2:85540743-85540765 TTCCTTAAGATTAGGGAAACTGG + Intronic
935985461 2:108668374-108668396 TTGCTGGAGGCTGGGGAGAATGG - Intronic
936137891 2:109912021-109912043 TTGCTGGAGGCTGGGGAGAATGG - Intergenic
936206806 2:110459464-110459486 TTGCTGGAGGCTGGGGAGAATGG + Intronic
938729656 2:134136775-134136797 TTGATGAAGAGGAGGGAAAGGGG - Intronic
938802596 2:134776866-134776888 TTGCTAAATACTAGGATAAAGGG + Intergenic
938878011 2:135554181-135554203 TTGCTGAGGACTGGGGAAGAGGG - Intronic
939013727 2:136877272-136877294 TTGCTAAAAATTAGGCAAAATGG - Intronic
939324347 2:140668763-140668785 TTTCTAAAAACTAGGGCAAATGG + Intronic
939949747 2:148455784-148455806 AAGCTGAAAAGTAGGGAAAATGG + Intronic
940965159 2:159828988-159829010 TTGCTGAGGACTAGGAGACAGGG + Intronic
942247599 2:174022258-174022280 TTGGTGAAGACTAAGGAGACAGG + Intergenic
942575440 2:177358198-177358220 TTGCTGGAGACTAAGGATGATGG - Intronic
943044336 2:182841050-182841072 GTGAAGAAGCCTAGGGAAAAGGG - Intronic
945872419 2:215242392-215242414 CTGCTGAGGACTAGCAAAAAAGG - Intergenic
946119867 2:217500626-217500648 TTACTGGAGTCTAGTGAAAATGG - Intronic
946800949 2:223415661-223415683 TTGCTTAAGAATATGGAAACTGG + Intergenic
946967202 2:225049170-225049192 TTGCTGTAGACCATGGAAAGAGG - Intergenic
947042708 2:225941892-225941914 TTGCTGAAGAGTAGTGAGACTGG + Intergenic
947772408 2:232681223-232681245 TTGTTCAATTCTAGGGAAAAAGG - Intronic
1173051479 20:39566269-39566291 TTTCTGAAGATTTGGTAAAATGG + Intergenic
1173200909 20:40954593-40954615 TTGGTCAAGAGCAGGGAAAATGG + Intergenic
1177616591 21:23529805-23529827 TTGGTGAAGATGTGGGAAAAAGG + Intergenic
1177955088 21:27588352-27588374 TTGATGAAGACAAAAGAAAAAGG + Intergenic
1182459127 22:30471860-30471882 TTCCGGAAGACCAGGGGAAAGGG - Intronic
1182912646 22:33998813-33998835 TTGCTGAAAACCAGTGATAAGGG + Intergenic
1182961267 22:34477509-34477531 TTGGTGAAGATTAGAGCAAAGGG - Intergenic
949326431 3:2870452-2870474 TTTCTGAAGATGAGAGAAAAGGG + Intronic
950682665 3:14595769-14595791 ATGCTGAAGCTCAGGGAAAATGG - Intergenic
951643577 3:24863080-24863102 GTGCTGAAGAATAAGGAAAGAGG + Intergenic
952848496 3:37708800-37708822 GTGCTGAAGAGTACGGAAATGGG - Intronic
954919548 3:54178067-54178089 TAGCAGAAGACAAGGTAAAAAGG + Intronic
955101755 3:55856995-55857017 TTGCCAGAGACTAAGGAAAAGGG + Intronic
956992249 3:74780481-74780503 TTGATGAAGACTGGGGAGAGTGG + Intergenic
957398648 3:79678950-79678972 TTAATGAATACTATGGAAAAAGG + Intronic
958039345 3:88207473-88207495 TTGCTGAAAACAAGTGATAAAGG - Intergenic
958704112 3:97632009-97632031 TTGCTGAAGAGTGAGGAAAAGGG - Intronic
959299549 3:104579835-104579857 TTGCTGCTGCCTTGGGAAAAAGG - Intergenic
959683392 3:109121182-109121204 TTTCTGAAGACTGGGTCAAATGG - Intergenic
960050068 3:113231041-113231063 TTGCTGGAGATTAAGGAATATGG + Intronic
960263502 3:115594271-115594293 CTACTGAAGGCTAGAGAAAAAGG + Intergenic
960347474 3:116552182-116552204 TTTCTGAAGACAATGGAATATGG - Intronic
960381188 3:116964209-116964231 TTGTTGAAGATATGGGAAAAGGG + Intronic
962050126 3:131804824-131804846 TCGCTGATGACAAGGGCAAATGG - Intronic
963626335 3:147678752-147678774 TTGCTGAAGAAAAGGTAAAATGG - Intergenic
963890458 3:150630902-150630924 TTTCTGAAGCCTAGGGGAAAAGG - Intergenic
965356476 3:167680482-167680504 TTGCTCAAGATTAAGGATAATGG - Intergenic
965470471 3:169084309-169084331 TTGTTTAAAACTAGGGAAAAAGG - Exonic
966211974 3:177462975-177462997 TTCCTTAAGAAGAGGGAAAAGGG + Intergenic
966902455 3:184496604-184496626 TTGCAGAAGACTAGAGGGAAAGG - Intronic
967412719 3:189183105-189183127 TGGCTGACGCTTAGGGAAAATGG - Intronic
967454900 3:189673318-189673340 TTTCTTAAGATTAGAGAAAAGGG + Intronic
967461623 3:189754113-189754135 TTGCTGATGTCCAGGCAAAATGG - Intronic
968907289 4:3460366-3460388 TTGCTGAAGGCAAAGGGAAATGG + Intergenic
970013066 4:11481833-11481855 ATGTTGAAGAATAGGGAAATGGG - Intergenic
971023426 4:22563037-22563059 TTGCTGAAAACTAGTGGTAAAGG + Intergenic
971126710 4:23762257-23762279 TTGCTGAAGGCAAAGGAAATGGG + Intronic
971402787 4:26292217-26292239 GGGCTGAGGAGTAGGGAAAATGG - Intronic
971751519 4:30655803-30655825 TGGCTGAAAACAAGGAAAAATGG - Intergenic
971864357 4:32150187-32150209 TTGTTGAAGAGTAGTGAAAATGG + Intergenic
974828981 4:67167061-67167083 TTGCTGAAGAGAATGCAAAATGG + Intergenic
975659548 4:76674904-76674926 TTGCTGAAGAGTGGGGGGAATGG - Intronic
975974205 4:80076365-80076387 TTAGTCAAGACTAGGGATAAAGG - Intronic
976474116 4:85462835-85462857 TTGCTGAGGACAGAGGAAAAGGG - Intergenic
977106967 4:92898598-92898620 TTGCAGAAGAGGAGAGAAAAAGG + Intronic
978038188 4:104022883-104022905 ATGCGAAAGACTAGGGCAAATGG - Intergenic
980524756 4:133975318-133975340 TTGCTGCAGACTGGGGGAAGGGG + Intergenic
981418115 4:144517226-144517248 TTGCTGAAGAGATGGGGAAACGG + Intergenic
983648854 4:170019079-170019101 TTGCCTAGGACCAGGGAAAACGG + Intronic
987819319 5:22941555-22941577 TTCCTGAAAACTAGAGAAAGAGG - Intergenic
989415591 5:41171730-41171752 TGGCTGAAGACTTTGGCAAATGG - Intronic
990590382 5:57256843-57256865 TAGCTTAAGAGTGGGGAAAAAGG - Intronic
991289755 5:65022164-65022186 TTACTGAAGACAAGTGAAACAGG + Intergenic
991968343 5:72113527-72113549 TAACTGAAGCCAAGGGAAAATGG + Intronic
992008158 5:72499881-72499903 TTGCTGAAGCCTGGACAAAATGG - Intronic
992474811 5:77091049-77091071 TTGGTGAAGATTAGAGAAATGGG - Intergenic
992849141 5:80787000-80787022 TTATTGAAGACAAGGGGAAAAGG - Intronic
993570264 5:89528598-89528620 TTGCAAAAGACAATGGAAAATGG + Intergenic
994498776 5:100547255-100547277 TTTCTGAGGACTAGGGACAGTGG + Intronic
995618759 5:113999068-113999090 CTGCTGAAGAATAAAGAAAAAGG - Intergenic
995832252 5:116366148-116366170 TTGCTTAAGACTAGGATAGATGG + Intronic
997479252 5:134171341-134171363 TTGTGGAAGCCAAGGGAAAAGGG - Intronic
998106461 5:139472069-139472091 TTGCTGGAGACCTGGGAAAAGGG + Intergenic
999139975 5:149354061-149354083 TGTCTAAAGTCTAGGGAAAAGGG + Exonic
999367508 5:151032772-151032794 TGGCAGAGGACTGGGGAAAATGG + Intronic
999652602 5:153782369-153782391 ATGATGAAGACTAGTGAACAGGG + Intronic
1000179726 5:158796532-158796554 ATGATGAAGACTTGAGAAAAAGG + Intronic
1001352600 5:170983889-170983911 CTGCTGAAGAGGAAGGAAAATGG + Intronic
1002759930 6:193465-193487 TGGCTGAAGACTAGGAGAGATGG + Intergenic
1004629912 6:17411389-17411411 TTGCTGGTGAATATGGAAAATGG - Intronic
1006311828 6:33266503-33266525 CTGATGAAGACTGGGGACAAAGG + Intronic
1006687234 6:35846053-35846075 TTGCCAAAGAATAGGGGAAAAGG + Intronic
1008838713 6:55870348-55870370 TTGTTGAAGAAGAGAGAAAAAGG + Intronic
1008864848 6:56197709-56197731 TTGGTGAAGATTGGAGAAAAGGG + Intronic
1010142521 6:72627621-72627643 GTGGTTAAGACTTGGGAAAATGG + Intronic
1010314743 6:74434796-74434818 TTGCAGAAGACGATGGAGAATGG - Intergenic
1010835612 6:80584396-80584418 TTCCTAAAGAGGAGGGAAAAGGG - Intergenic
1012465676 6:99514680-99514702 TTGCCCAAGAGTAGGAAAAAAGG - Intronic
1013335228 6:109151927-109151949 TTGTTGAAAACTAGTGATAAAGG - Intronic
1013924968 6:115461202-115461224 TTGCTGAAGAGATGGGAAAATGG - Intergenic
1015530526 6:134217214-134217236 TGACTGAAAACTAGGGAAGATGG + Intronic
1020439749 7:8204876-8204898 TTGCAGAACAGTGGGGAAAATGG + Intronic
1020462691 7:8442561-8442583 TTGTAGAAGACGAAGGAAAATGG - Intronic
1020527124 7:9276066-9276088 TTGCTTAAGACTGGAGAAAAGGG - Intergenic
1021285369 7:18775026-18775048 TTCCTGAATATTAGGGAATAGGG + Intronic
1022042662 7:26595133-26595155 ATGATGAAGACCAGGGAAAAGGG + Intergenic
1022152845 7:27626839-27626861 TAGATGAAGACTTGGGAGAAAGG + Intronic
1023070137 7:36421927-36421949 TTGATGAAGAACATGGAAAAGGG + Exonic
1024028682 7:45436586-45436608 CTGCTGAAAACTAGAGACAAAGG + Intergenic
1024720374 7:52130142-52130164 TTACTTAAGACTAGGAAAATAGG - Intergenic
1028547974 7:92026122-92026144 TTGCTTGAGCCTAGGGAATATGG + Intronic
1028730701 7:94145197-94145219 TTGATAAAGATTAAGGAAAAAGG - Intergenic
1029803529 7:102974557-102974579 TTGCTGACGACTGGAGAAATGGG + Intronic
1030352008 7:108500269-108500291 ATGGTGAAAAATAGGGAAAATGG - Intronic
1031113482 7:117640448-117640470 TTTCTGAAGAAAAGGGAACATGG + Intronic
1032270517 7:130400464-130400486 ATGCTGAAGACTCGAGCAAAAGG - Intronic
1033541489 7:142359926-142359948 TTGCTGAAGACCAGAATAAAAGG + Intergenic
1033786519 7:144737763-144737785 ATGCTGGAGACTAGGGCAATAGG - Intronic
1035343901 7:158185936-158185958 CTTCTGAAGACTGGGGACAAGGG - Intronic
1038017459 8:23528100-23528122 TTGCTCCAGTCTGGGGAAAAAGG - Intergenic
1041365243 8:57095838-57095860 TGGCTGAAGAAAAGGGAAAATGG - Intergenic
1041916770 8:63146402-63146424 TTGCCGAAGACTGGAGAAATGGG - Intergenic
1042322051 8:67486366-67486388 TTGCAGATCAATAGGGAAAATGG + Intronic
1042375394 8:68045580-68045602 TTGCTGTAGGTAAGGGAAAAAGG + Intronic
1043400586 8:79880460-79880482 TTGTTGAAGATTATGTAAAAAGG - Intergenic
1043613502 8:82094770-82094792 TTGCTCACCACCAGGGAAAAGGG + Intergenic
1044491481 8:92822418-92822440 TAGATGCAGACTAGGTAAAATGG - Intergenic
1044513359 8:93109807-93109829 TTGCTAAGGAGAAGGGAAAAAGG + Intergenic
1044756961 8:95473581-95473603 TTGCCAAAGACTAGGGGAAAGGG - Intergenic
1046542531 8:115604739-115604761 ATTCTGGAGACTTGGGAAAATGG - Exonic
1046841247 8:118859872-118859894 TTGTTAAAGACTAAGGAAACTGG - Intergenic
1046917134 8:119689747-119689769 TTTCTGAAGATTAAGTAAAATGG - Intergenic
1047578609 8:126186901-126186923 AAGCTGAAGAATAGGCAAAATGG - Intergenic
1047629406 8:126690822-126690844 TTGATCAAGACTAGGAAAAATGG + Intergenic
1048198985 8:132355750-132355772 TTTCCGAAGACTAGGCACAAAGG - Intronic
1048316408 8:133366160-133366182 TTCCTGAGGAATGGGGAAAAGGG + Intergenic
1050167634 9:2782446-2782468 TTGCTGAAGATTGGGGATACTGG - Intronic
1050466446 9:5929530-5929552 TTCCCAAAGACTGGGGAAAAGGG + Intronic
1050466800 9:5935201-5935223 TTACTTAAGACTAGGAGAAAAGG + Intronic
1052503682 9:29325451-29325473 TTTCTGAAGATAAGAGAAAAAGG + Intergenic
1052646708 9:31245722-31245744 TTACTGAAAACAAGAGAAAAAGG - Intergenic
1052915809 9:33923668-33923690 TTTCTGAAGACCAGGTAAGACGG + Intronic
1053185938 9:36016446-36016468 TAGCTGTACACTGGGGAAAATGG - Intergenic
1055825502 9:80319144-80319166 TTACTGAAGACCAGGGACAATGG + Intergenic
1056339763 9:85615262-85615284 TTGCTGAAGACTAGGGAAAATGG - Intronic
1056461414 9:86812921-86812943 TTGCTGAGGGCTATGGTAAAGGG + Intergenic
1056856275 9:90132246-90132268 GAGCTGGAGACTAGGGGAAAAGG - Intergenic
1056956036 9:91082085-91082107 TTGGAGGAAACTAGGGAAAAGGG + Intergenic
1057535869 9:95905682-95905704 TTGATGATGGCTTGGGAAAAAGG + Intronic
1057623858 9:96660486-96660508 TTGCTGTGGACAAGGGAATATGG - Intergenic
1058409337 9:104713757-104713779 TTGGAGAAGAATAAGGAAAAGGG - Intergenic
1058920321 9:109608284-109608306 TTGTTGAATAATAGGAAAAAAGG - Intergenic
1059044346 9:110849498-110849520 TTGATGAAGACATGGGAAAATGG + Intergenic
1059715239 9:116907246-116907268 CTGCTGCAGGCCAGGGAAAAGGG - Intronic
1060529121 9:124337840-124337862 TTGCTGATGAGAAGGTAAAATGG - Intronic
1061734070 9:132640389-132640411 TTGCTGAAGGGTAGGGAGCAAGG + Intronic
1062608061 9:137357173-137357195 TTTCTCAACACTAGTGAAAATGG - Intronic
1186983946 X:14990398-14990420 GGGCTGAGGAGTAGGGAAAATGG + Intergenic
1187346985 X:18474438-18474460 TTGTTGAGGATGAGGGAAAATGG - Intronic
1188108941 X:26174974-26174996 GTGCTAAAGAGTAGAGAAAATGG + Intergenic
1188234775 X:27714749-27714771 TTTTGGAAGAGTAGGGAAAATGG - Intronic
1188592560 X:31855968-31855990 TTTCAGGAGACTAGTGAAAATGG - Intronic
1190393838 X:49959873-49959895 TTGCTGAAGCAGAGTGAAAATGG - Intronic
1191578255 X:62731179-62731201 TTGCTGTAGAATATGCAAAAGGG - Intergenic
1191673998 X:63776119-63776141 TTGCTTAAGATTTTGGAAAAAGG - Intronic
1192136858 X:68610248-68610270 TGGCTGGAGGCTTGGGAAAAGGG + Intergenic
1192316056 X:70052800-70052822 TTGCTAAAGGGTAGGGAAGAAGG + Intergenic
1192695887 X:73415722-73415744 TTGTTGAGGACTTGGCAAAAGGG - Intergenic
1193948858 X:87773408-87773430 TGGCAGAAAACTAGAGAAAAAGG + Intergenic
1194967347 X:100303728-100303750 TTGCTGAAAAAAAGGGAAGAAGG - Intronic
1195429854 X:104776668-104776690 TTCCTGAAAACCAGGGCAAATGG + Intronic
1195992778 X:110699137-110699159 TTGCAGAAGAATTGGGGAAAGGG - Intronic
1196216535 X:113058765-113058787 TTGCTGATGAGAATGGAAAATGG - Intergenic
1196936248 X:120733925-120733947 ATGCTGGAGACTGGGGCAAATGG + Intergenic
1197886442 X:131222904-131222926 TCTCTGAAGACAAGGTAAAATGG - Intergenic
1198644220 X:138788558-138788580 TTCCTGAAGACAAGGCAAGAAGG - Intronic
1201540904 Y:15103597-15103619 GTGCTGAAGACCTGGGACAAGGG - Intergenic