ID: 1056339996

View in Genome Browser
Species Human (GRCh38)
Location 9:85619281-85619303
Sequence AGTTACACCATTCCAGAAGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 169}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056339996 Original CRISPR AGTTACACCATTCCAGAAGA GGG (reversed) Exonic
903739262 1:25549262-25549284 AGTGACAACATCTCAGAAGAGGG - Intronic
907502506 1:54891991-54892013 AATAAGAGCATTCCAGAAGAGGG + Intergenic
908789026 1:67762596-67762618 ACATACCCCATTCCAGTAGAAGG - Intronic
909671242 1:78190971-78190993 AGTTCAACCATTCTGGAAGATGG - Intergenic
911958821 1:104272269-104272291 AGTTAAACCATTGTGGAAGACGG - Intergenic
913145467 1:115985597-115985619 AATTAAACCATTGAAGAAGAAGG + Intronic
918794354 1:188873727-188873749 AGTTTAACCAATCCAGAAAATGG - Intergenic
920740015 1:208571838-208571860 AGTGCTACCAATCCAGAAGAAGG - Intergenic
921821911 1:219626750-219626772 ATTTACACCATTCAAGACGTGGG - Intergenic
923184593 1:231558446-231558468 AGTTCCATTATTTCAGAAGAAGG - Intronic
1063327510 10:5119240-5119262 ACTAACACCATGCCAGAACATGG + Intronic
1064890213 10:20162611-20162633 AGTTAAAACATACAAGAAGATGG - Intronic
1073020999 10:100443944-100443966 AATTTCAACCTTCCAGAAGAAGG + Intergenic
1074863235 10:117529093-117529115 AGTGACAGCATTAAAGAAGAGGG + Intergenic
1075114668 10:119616175-119616197 AGTTTCAAAATCCCAGAAGAGGG - Intergenic
1075947094 10:126443624-126443646 ATTGACACTATTCCAGAAGATGG + Intronic
1080553670 11:33396540-33396562 AGTTACGCAATGCCATAAGAAGG - Intergenic
1081060678 11:38471906-38471928 AGTTCAACCATTGCGGAAGACGG + Intergenic
1081211905 11:40346113-40346135 AGTTCAACCATTGCAGAAGACGG + Intronic
1082076408 11:47979505-47979527 AGTTTCACCAGGCCAGTAGAGGG - Intergenic
1082274601 11:50207815-50207837 AGTGGCAGCATTCCAGCAGAGGG - Intergenic
1083539057 11:63499068-63499090 AGTTACACCCATTCAGAAGCAGG + Intergenic
1084228493 11:67732485-67732507 AGTGACACCATCCTAGAATATGG - Intergenic
1090648325 11:128784414-128784436 AGTTAATTCATTTCAGAAGAGGG - Intronic
1092078277 12:5691528-5691550 AGTAAGAGCCTTCCAGAAGAAGG + Intronic
1094241015 12:28225005-28225027 AATTACACCATTTTTGAAGATGG - Intronic
1095676927 12:44931196-44931218 AGTTACTTTATTCCACAAGATGG - Intergenic
1096660531 12:53121293-53121315 AGTTCCACCAGTCCTGGAGAAGG - Exonic
1098140737 12:67448018-67448040 AGTTACAGATTTCCAGAAGGTGG + Intergenic
1098756880 12:74375143-74375165 CGTGACACCCTTCCAGAAAATGG + Intergenic
1103179222 12:118894086-118894108 AGTTCAACCATTGCAGAAGATGG + Intergenic
1103551881 12:121743931-121743953 AGTGACACCAATCCAGAGGAAGG - Intronic
1104698924 12:130886346-130886368 ATTTTCACCATTCCAATAGAAGG + Intergenic
1107039766 13:35936526-35936548 AATTCCATCATTCCAAAAGAGGG + Intronic
1107292603 13:38872884-38872906 AATTCCATCATTCCACAAGATGG - Exonic
1111267615 13:85838261-85838283 ACTTAAACAATTTCAGAAGAAGG - Intergenic
1111884424 13:94001839-94001861 AGCGACACCATTGCACAAGAGGG + Intronic
1112154388 13:96801434-96801456 ATTAACACCATTCAAGCAGAAGG - Intronic
1112914430 13:104529109-104529131 AGTTACAAATTTTCAGAAGACGG + Intergenic
1118914314 14:70089145-70089167 AGTAACAACATTCTAGAAAAAGG - Intronic
1119360333 14:74043862-74043884 AGGAACAGCATTCCAGAAGGAGG - Intronic
1120666754 14:87315447-87315469 AGTTACACCATTGTGGAAGTTGG - Intergenic
1120922449 14:89767255-89767277 AGTTACACCACACCAGGCGAGGG + Intergenic
1125460340 15:39900685-39900707 TGACCCACCATTCCAGAAGAAGG + Intronic
1126977570 15:54201260-54201282 ATTGACACTATTCCAAAAGATGG + Intronic
1127850495 15:62907966-62907988 AGCTACTCCATTACAGAATAGGG - Intergenic
1128401730 15:67289511-67289533 AGTTACACCATTCATTGAGATGG + Intronic
1128800066 15:70491696-70491718 AGTTTCACCATTCCATAAATGGG + Intergenic
1131267844 15:90928578-90928600 AGCTACACCATTCAAGAGCACGG + Intergenic
1131581075 15:93644489-93644511 GGTTACATCATTCCTGAAGCTGG - Intergenic
1133549973 16:6844763-6844785 AGTTCAACCATTGCAGAAGATGG - Intronic
1134613953 16:15634967-15634989 AGATACATCATTTCAGAAGCTGG + Intronic
1138894984 16:61192927-61192949 ATTTTCAGCATTCTAGAAGAAGG + Intergenic
1139166596 16:64573210-64573232 AGTGGCACCAATACAGAAGATGG - Intergenic
1140190874 16:72815082-72815104 CGTTACACCATTTCTGTAGATGG + Intronic
1141329144 16:83092452-83092474 AGTTAGACAGTTCCAGATGAAGG - Intronic
1142306359 16:89288138-89288160 TGTTACCTCATTCCAGACGAGGG + Intronic
1143973750 17:10814927-10814949 GGATAGAACATTCCAGAAGAGGG - Intergenic
1144516558 17:15921458-15921480 ATTTACACGATTACAGAAAATGG - Intergenic
1151079143 17:71308344-71308366 ACTGACACTATTCCAAAAGATGG + Intergenic
1153425373 18:4957308-4957330 ACTTAAACTATTCCAAAAGATGG + Intergenic
1157218884 18:45810310-45810332 ATTGACACTATTCCACAAGATGG + Intergenic
1158345690 18:56514229-56514251 AGCTACACCATTACAGGAGAAGG - Intergenic
1160590140 18:79939789-79939811 AGCTCAACCATTGCAGAAGATGG + Intronic
1163042682 19:14614251-14614273 AGTTCCCACATTTCAGAAGAGGG + Intergenic
1165969920 19:39619067-39619089 AGTTCAACCATTCTGGAAGATGG - Intergenic
926308893 2:11660188-11660210 AGTTACACCATTGCAAAGGGAGG + Intronic
927941079 2:27103132-27103154 AGTTAACCCAGTCCAGAAGTGGG - Intronic
930482836 2:51971112-51971134 AGTTGAATTATTCCAGAAGAGGG + Intergenic
931053766 2:58444203-58444225 AGCTAGACAATTCTAGAAGATGG - Intergenic
932022580 2:68102587-68102609 AGTGACACAATTCCAGACTAAGG + Intronic
932380521 2:71277591-71277613 ATTTACACCATTCCAAAATCTGG - Intronic
936957778 2:118040600-118040622 AGTTACAGTGTTCCATAAGAGGG - Intergenic
938681743 2:133699313-133699335 GCTCTCACCATTCCAGAAGAGGG + Intergenic
939345932 2:140966131-140966153 AGTTCAACCATTGTAGAAGACGG - Intronic
940627198 2:156189940-156189962 TGTTACAGGATTTCAGAAGAGGG - Intergenic
941406407 2:165094188-165094210 AGTTACCACATTCCAAAAAAAGG - Intronic
944093621 2:195942273-195942295 AGGTAGCACATTCCAGAAGAGGG + Intronic
944251658 2:197585039-197585061 GGGTTCACCATTCCAGAATAAGG + Intronic
944544171 2:200782571-200782593 ATCTGCCCCATTCCAGAAGAGGG - Intergenic
947154259 2:227145569-227145591 GGTCACACCATTCCAAAGGATGG + Intronic
947384860 2:229580896-229580918 ACATAAACCACTCCAGAAGAGGG + Intronic
1169025475 20:2367101-2367123 ATTTATACCATTCCAAAAAATGG - Intergenic
1169562316 20:6815049-6815071 ACTTACACCAGACCAAAAGAAGG + Intergenic
1169668784 20:8071236-8071258 ATTTCCACCTTTCCAGAAGGCGG - Intergenic
1170343084 20:15351181-15351203 AGTTACACTATGACACAAGAGGG + Intronic
1172573602 20:35989461-35989483 AGTTACAAGATTTCAGGAGAGGG + Intronic
1173108587 20:40162560-40162582 ATTTACACTATTACAAAAGAGGG + Intergenic
1175794436 20:61762839-61762861 AGTTACACCTTTCCAGGAGGGGG + Intronic
1179595746 21:42441952-42441974 AGTCAGAATATTCCAGAAGATGG + Intronic
1184953826 22:47866344-47866366 AATTACACCATTTGAAAAGAAGG - Intergenic
951184090 3:19691944-19691966 ATTGACACTATTCCACAAGATGG + Intergenic
952714635 3:36467389-36467411 ATTGACACTATTCCAAAAGACGG - Intronic
952732782 3:36656776-36656798 ATTGACACCATTCCACAGGATGG + Intergenic
953231660 3:41070745-41070767 ACTTACACCATGACTGAAGAAGG + Intergenic
955613768 3:60784217-60784239 AGTTACATCATTCCAGGATTGGG + Intronic
956005718 3:64776536-64776558 AGTGAGACCAATGCAGAAGACGG + Intergenic
958833864 3:99120806-99120828 AGTTACATCCATCAAGAAGAGGG - Intergenic
964683003 3:159362923-159362945 AGTTACCCCAGTACAGCAGAAGG - Intronic
968373317 4:15514-15536 AGTTCAACCATTGTAGAAGATGG + Intergenic
968374856 4:31301-31323 AGTTCAACCATTGTAGAAGATGG + Intergenic
968989355 4:3898455-3898477 AGTGACACCATCCTAGAATATGG - Intergenic
970428166 4:15964351-15964373 AGTGAGAGCCTTCCAGAAGAGGG + Intronic
974530242 4:63098436-63098458 AGGTACACCAGTCCCCAAGATGG - Intergenic
975149522 4:71005357-71005379 AGTGAGACCAATGCAGAAGACGG - Intronic
976100841 4:81561484-81561506 AGTTAAACCATTGTGGAAGATGG - Intronic
976103745 4:81594016-81594038 AGGAACAACTTTCCAGAAGAGGG + Intronic
978158223 4:105513813-105513835 ATTGACACTATTCCACAAGATGG - Intergenic
978316648 4:107445180-107445202 ATTGACACTATTCCACAAGATGG - Intergenic
980825109 4:138063523-138063545 AGTGACTTCATTCCTGAAGATGG - Intergenic
981106459 4:140887067-140887089 AGTTACACCAGTCAGGAAAATGG - Intronic
983972401 4:173890682-173890704 TGTGACACTATTCCTGAAGAAGG + Intergenic
985460183 4:190097744-190097766 AGTTCAACCATTGTAGAAGATGG - Intergenic
985462079 4:190117054-190117076 AGTTCAACCATTGTAGAAGATGG - Intergenic
987391121 5:17376319-17376341 AGTTCAACCATTGTAGAAGATGG - Intergenic
988400940 5:30759534-30759556 AATGACACCAGTCCAGAAAAGGG - Intergenic
988891524 5:35622426-35622448 AGTTATACGATTCCATAATATGG - Intronic
990339761 5:54810533-54810555 AAGTAGAACATTCCAGAAGAAGG + Intergenic
991327434 5:65451511-65451533 GGAAACACCATTCCAGAAAATGG - Exonic
991778558 5:70110041-70110063 AGTTCCACCAGACCAGACGAGGG - Intergenic
991857848 5:70985508-70985530 AGTTCCACCAGACCAGACGAGGG - Exonic
991871005 5:71110394-71110416 AGTTCCACCAGACCAGACGAGGG - Intergenic
993181133 5:84554248-84554270 AGTTCAACCATTGCGGAAGACGG + Intergenic
993757729 5:91751594-91751616 AGTGAGACCAATGCAGAAGACGG - Intergenic
993765364 5:91849609-91849631 AGTTACATTTTTCCAGAAAAAGG - Intergenic
993959328 5:94277671-94277693 AGTTCAACCATTGCAGAAGGTGG + Intronic
995882068 5:116854200-116854222 AGATACACCATTAGAGAAGCTGG - Intergenic
996020089 5:118581180-118581202 GGCTATACTATTCCAGAAGACGG - Intergenic
997413154 5:133705434-133705456 GGTCCCACCATTCCAGAAGGAGG - Intergenic
999985602 5:157002029-157002051 AGTTAAACCATTGTAGAAGATGG + Intergenic
1000583440 5:163063589-163063611 AGTTACATCATTGCAGAGTACGG + Intergenic
1004600747 6:17147630-17147652 AGTTCCACCATTGTGGAAGATGG - Intergenic
1005171921 6:22996601-22996623 ATTAACACCATTCAAGAAGAGGG + Intergenic
1009959603 6:70501854-70501876 AGTGACACCATCGCAGAAGGTGG - Intronic
1012619662 6:101326778-101326800 AGAAACATCATTCCATAAGAAGG - Intergenic
1013847130 6:114466867-114466889 ATTTACACATTTCCAGAGGAGGG + Intergenic
1015136481 6:129877867-129877889 AGTTCAACCATTGTAGAAGATGG - Intergenic
1015555634 6:134458886-134458908 AGGTACTCCATATCAGAAGAGGG + Intergenic
1018368592 6:163147707-163147729 AGTTACAGCCTTCCATAATATGG + Intronic
1018971603 6:168533360-168533382 AGTTCCACCATTTCAGATGGAGG - Intronic
1020312197 7:6876565-6876587 AGTGACACCATCCTAGAAGATGG - Intergenic
1023113665 7:36839445-36839467 AGATACACTATTGCAGAGGAAGG + Intergenic
1027198726 7:76048879-76048901 AGAACCACCATTCTAGAAGATGG - Intronic
1027399125 7:77789378-77789400 AGTTACACAATTTTAGAACAGGG - Intergenic
1030903198 7:115149631-115149653 ATTTACGTCATTCCAGATGATGG - Intergenic
1031173913 7:118325059-118325081 AGCTACCCCATGCCAGCAGAGGG + Intergenic
1033288123 7:140059948-140059970 AGGAAGAACATTCCAGAAGAGGG + Intronic
1033532799 7:142282446-142282468 AGTTACACCCTCCCACAGGATGG - Intergenic
1033997218 7:147365533-147365555 AGTTATAACATTCAAAAAGATGG - Intronic
1037431115 8:18814298-18814320 GCTTTCACTATTCCAGAAGAGGG + Intronic
1038749579 8:30283081-30283103 GTTTTCCCCATTCCAGAAGATGG + Intergenic
1040630773 8:49207392-49207414 AGTTCAACCATTACGGAAGATGG - Intergenic
1041597578 8:59674663-59674685 AGTTGTTCCATTCCAGAAAAAGG - Intergenic
1041801416 8:61804508-61804530 AGTTCCACCAAACAAGAAGATGG - Intergenic
1043859523 8:85299850-85299872 AGTTCAACCATTGCGGAAGACGG + Intergenic
1044947596 8:97404908-97404930 ACTGACACTATTCCAAAAGATGG - Intergenic
1044992586 8:97809276-97809298 AGCTACACAATTCCAGTAGCGGG - Intronic
1045113172 8:98952649-98952671 AGATACAACCTTCAAGAAGACGG + Intergenic
1046101797 8:109622873-109622895 TGTTCCACATTTCCAGAAGAAGG + Intronic
1046981997 8:120346302-120346324 AGATATTCCATTCCAGAAGCAGG + Intronic
1048467545 8:134679501-134679523 AGTTCAACCATTGCGGAAGACGG + Intronic
1050123040 9:2327571-2327593 GCTTACACCATTGCAGAAGCTGG + Intergenic
1056339996 9:85619281-85619303 AGTTACACCATTCCAGAAGAGGG - Exonic
1058001736 9:99872786-99872808 AATTACACCATTTCAGAAGTGGG - Intergenic
1058182420 9:101815268-101815290 AGTGAGACCATCTCAGAAGATGG + Intergenic
1058842762 9:108925946-108925968 AGTTAGACCATAACAGAAGTTGG + Intronic
1061458242 9:130714286-130714308 AGGTACCCCTTTCCAGAAGAGGG - Exonic
1061472503 9:130837595-130837617 AGTGACACCTTCCTAGAAGAAGG - Intronic
1203574366 Un_KI270744v1:162850-162872 AGTTCAACCATTGTAGAAGATGG - Intergenic
1187108511 X:16270277-16270299 AGTTCAACCATTGTAGAAGATGG - Intergenic
1187878742 X:23826704-23826726 AGTTACACCATTGCTCAAGAGGG - Intergenic
1189218903 X:39353468-39353490 ATTGACACTATTCCAAAAGATGG - Intergenic
1189275123 X:39779837-39779859 AGTAATATCATTCCAGAAGTGGG + Intergenic
1190325993 X:49207071-49207093 ATTTTCACCATCCCAGAAGAAGG - Exonic
1191616806 X:63177830-63177852 GGTGACTCCATTCCTGAAGAAGG + Intergenic
1191619491 X:63201093-63201115 GGTGACTCCATTCCTGAAGAAGG - Intergenic
1193236420 X:79113048-79113070 AGATATTCCATACCAGAAGAGGG + Intergenic
1195141709 X:101967334-101967356 AGTTACACTCTTTCAGAAAAGGG - Intergenic
1198114699 X:133533903-133533925 AGTAACACCAACCCAGAAGAAGG - Intergenic
1198645596 X:138802485-138802507 AGTGAGACCAATGCAGAAGATGG - Intronic
1198864800 X:141110350-141110372 ATTTACAACATTCTAGAAGGAGG - Intergenic
1198897889 X:141477041-141477063 ATTTACAACATTCTAGAAGGAGG + Intergenic
1201014295 Y:9583273-9583295 ATTTACAACATTCTAGAAGGAGG - Intergenic
1201492867 Y:14561647-14561669 AGTTCAACCATTGCGGAAGAGGG - Intronic
1202017911 Y:20431623-20431645 AGTTCAACCATTGCGGAAGAAGG + Intergenic