ID: 1056340601

View in Genome Browser
Species Human (GRCh38)
Location 9:85627657-85627679
Sequence CTGTCTCAGCAGGGGCAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 267}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056340601 Original CRISPR CTGTCTCAGCAGGGGCAAAG GGG (reversed) Intronic
900299230 1:1968879-1968901 CTGTCTCATCTGGGGCAAGGTGG - Intronic
901028092 1:6289877-6289899 CTGTCTTAGCAGGTGGAAGGGGG - Intronic
902082902 1:13833465-13833487 CTGGCTCAGCAGGTGCAGCGTGG - Intergenic
902625765 1:17675381-17675403 CTGGCTAAGCACGGGCAAATGGG + Intronic
902642135 1:17773896-17773918 CTGTCTGTGCAGGGCCACAGAGG + Intronic
905974667 1:42165700-42165722 CTGTATCTGCAGGGGCAAGGGGG - Intergenic
906237817 1:44222380-44222402 CTGTCCCAGTAGGCTCAAAGTGG + Intronic
906666556 1:47626207-47626229 CTGTCTCAGTAGGGGTGAGGTGG + Intergenic
909691298 1:78410284-78410306 CTGCATCAGCAGTGGAAAAGTGG + Intronic
910191387 1:84599490-84599512 CAGTCACAGCAGGGAGAAAGTGG + Intergenic
911595409 1:99793751-99793773 CTATCTCAGCAAGGGGAATGCGG + Intergenic
911853058 1:102842688-102842710 CTGTGGCAGCAGTGGCTAAGGGG + Intergenic
912313336 1:108645029-108645051 CAGTGTCAGCAGTGGCAATGTGG - Intergenic
912642603 1:111361611-111361633 CTATCTCAGCAAGGGGAATGTGG + Intergenic
912924708 1:113904007-113904029 CTGTCTCAAATGAGGCAAAGTGG + Intronic
916231870 1:162548832-162548854 CTGACCCAGCAGGGGCACAAAGG - Intergenic
916835911 1:168544450-168544472 CTCTCTCAGGAGGGGAAGAGAGG + Intergenic
916838557 1:168576124-168576146 CTCTCTCAGGAGGGGAAGAGAGG - Intergenic
917241806 1:172956727-172956749 CTGCCTCAGGAGAGGCAAAGGGG - Intergenic
919144927 1:193621823-193621845 CTGTCTCAAAAGAGGGAAAGTGG - Intergenic
919484464 1:198129878-198129900 CTGTCTCAGCAAGAGGAATGAGG + Intergenic
919698515 1:200606715-200606737 TTGGCTCAGCAAGGGCAAAGAGG - Intronic
920050695 1:203162959-203162981 CTGTCTCAGCAGCCACACAGCGG - Intronic
921194307 1:212739048-212739070 CTGGATCAGCAAGGGCACAGTGG - Intronic
921378597 1:214500688-214500710 CTCTCACAGAAGGGGAAAAGGGG + Intronic
922157157 1:223049482-223049504 CTGTCTCAGGAAGGACAAATAGG + Intergenic
924575446 1:245276811-245276833 CTGTCTCTGTAGGGACAAAGAGG + Intronic
1063951416 10:11226653-11226675 CTGCCACAGCAGGGGCATCGGGG + Intronic
1064963769 10:20994902-20994924 CTGTCTCAGGAGTGGCAGAGAGG + Intronic
1065958173 10:30711213-30711235 CTGTCAAACCAGGGGCAAAGGGG - Intergenic
1071535286 10:86423832-86423854 CTGTCTCTGCAGGAACAATGGGG - Intergenic
1071681161 10:87707049-87707071 CAGTGTCAGAAGGGGCCAAGAGG - Intronic
1072668655 10:97413188-97413210 ATGTGGCAGCGGGGGCAAAGAGG + Intronic
1074229836 10:111522935-111522957 CTCTCTCTGCAAGGGCAATGGGG - Intergenic
1074696132 10:116051550-116051572 CTGTCTGACCAGTGGCAGAGGGG - Intergenic
1074731356 10:116379869-116379891 CGGTGGCAGCAGGAGCAAAGTGG - Exonic
1075717021 10:124561649-124561671 CAGTGTCAGCAGAGGCCAAGTGG + Intronic
1076208593 10:128623099-128623121 TAGTCACACCAGGGGCAAAGTGG + Intergenic
1076518379 10:131062830-131062852 CTGTCTCAGCAGGAAGAAGGAGG - Intergenic
1081591486 11:44426303-44426325 AGGTCTCAGCAGGGGTGAAGCGG - Intergenic
1081995594 11:47361600-47361622 CTGTCTCATGTGGGCCAAAGAGG + Intronic
1082969599 11:59005507-59005529 CTATCTCAGCAAGGGGAATGTGG - Intronic
1084786879 11:71447913-71447935 CTGGCTCAGCACTGACAAAGAGG + Intronic
1085338732 11:75717725-75717747 CTGCCTCAGCAGGGGCAAGGAGG + Intergenic
1085947499 11:81289446-81289468 TTCTCTCAGAAAGGGCAAAGGGG - Intergenic
1086392051 11:86375216-86375238 CTGGCTCAGCGAGGGCAGAGTGG - Exonic
1087951480 11:104225709-104225731 CTGTATTAGCAGGAGCAAAAAGG - Intergenic
1088625876 11:111730146-111730168 CTGTCTTTTCAGAGGCAAAGTGG + Exonic
1089444994 11:118544857-118544879 CCATCTCAGCTGGGGCAGAGGGG + Exonic
1089711045 11:120315006-120315028 CTGCCACAGCAGGGCCCAAGAGG + Intronic
1091533255 12:1380528-1380550 CTGTCTTAGCTAAGGCAAAGGGG + Intronic
1091854010 12:3724313-3724335 CTGGCTCAGCAGGAGCCTAGAGG - Intronic
1092907848 12:13118155-13118177 TTTTCTCAGATGGGGCAAAGTGG + Intronic
1093780644 12:23132896-23132918 AAGTCTGAGCAGGGGAAAAGTGG - Intergenic
1094310059 12:29070408-29070430 CTGTCATAGCAGTGGCCAAGAGG - Intergenic
1095450958 12:42329973-42329995 CTGTCTCAGCAAGGGGAATGCGG + Intronic
1096684326 12:53277773-53277795 CTGTCTCAGCATGGGCCATCTGG - Intronic
1097240558 12:57572253-57572275 CTGTCTCAGAAGGTGGTAAGTGG + Exonic
1097405844 12:59188711-59188733 GTGTCTCGGCAGGGGAAATGGGG + Intergenic
1101249475 12:102917587-102917609 CTGTTTCAGCTGGGGGTAAGGGG - Exonic
1101839485 12:108317497-108317519 CTCTCTCAGCTGGTTCAAAGTGG + Intronic
1102283373 12:111635790-111635812 CATTCTCAGCAAGTGCAAAGGGG + Intergenic
1102447004 12:113010905-113010927 CTGTGTCAGCAGGGGCAGAAAGG - Exonic
1104908529 12:132228381-132228403 CTGCCTCGCCAGAGGCAAAGAGG - Intronic
1104908547 12:132228452-132228474 CTGTCTTGCCAGAGGCAAAGAGG - Intronic
1104908564 12:132228523-132228545 CTGTCTCGCCAGAGGCAAAGAGG - Intronic
1106101086 13:26695570-26695592 CTGTCCCAGCTGGGGCCACGGGG - Intergenic
1106219437 13:27733435-27733457 TTGTCTTAGCAGGGGTAAAAGGG - Intergenic
1107886077 13:44875089-44875111 CTGTCAGAGCTTGGGCAAAGTGG + Intergenic
1109397063 13:61773748-61773770 CTGTCCCAGCAGGGTCAGTGGGG + Intergenic
1113426396 13:110211912-110211934 CTGTCTCCCCAGGGGGAGAGAGG - Exonic
1113429438 13:110236891-110236913 CTGTCTCAGGAGGGGACAATGGG + Intronic
1113467595 13:110523332-110523354 CTGCCTCTGCAAGGGCAAGGGGG + Exonic
1114074243 14:19146331-19146353 CTGTCACAGAAGGAGCAAGGGGG + Intergenic
1114088025 14:19253644-19253666 CTGTCACAGAAGGAGCAAGGGGG - Intergenic
1114437918 14:22723556-22723578 CTGGCTCTGCAGGGGAACAGGGG + Intergenic
1116351339 14:43867639-43867661 GCATCTCAGCAGGAGCAAAGAGG - Intergenic
1118309729 14:64683456-64683478 CTGTCTCCGCTGGGGCAGAAAGG + Intergenic
1118383923 14:65239620-65239642 CTGGCTGAACAAGGGCAAAGGGG + Intergenic
1118654682 14:67933874-67933896 CTGACTCAGCAGGAGCATAGAGG - Intronic
1118745139 14:68768007-68768029 GTGTCTGAGAAGGGCCAAAGGGG - Intergenic
1119029802 14:71183175-71183197 CCGCCTCAGGAGGGGCACAGTGG - Intergenic
1120958567 14:90104332-90104354 CTGTTTTAGGAGGGGAAAAGGGG - Intronic
1121637487 14:95463570-95463592 CTGTCCCAGCTGGGCCAGAGGGG + Intronic
1121673155 14:95729258-95729280 CTATCTCAGCAAGGGGAATGCGG - Intergenic
1122731639 14:103803933-103803955 CTGTTACAGCAGGGGAGAAGAGG - Intronic
1123178791 14:106447473-106447495 CTATCTCAGCAAGGGGAATGTGG + Intergenic
1124890773 15:33730849-33730871 CTGACTCTGCATGGGCAACGTGG - Intronic
1125418189 15:39474978-39475000 CTGTGTCTGCTGGGGCAAAGAGG + Intergenic
1128207983 15:65869774-65869796 CTGTCTGAGCGGGGGAGAAGAGG - Intronic
1128354918 15:66919354-66919376 CAGCCTGAGCAGGGGCAAGGAGG + Intergenic
1128414263 15:67429750-67429772 CTGACGCAGGAGGGGCAAAGGGG + Intronic
1128612649 15:69086462-69086484 CTGCATCAGGAGGGGAAAAGGGG + Intergenic
1130648937 15:85751352-85751374 CTGTTTCTTCAGGGGCACAGTGG + Intergenic
1130693848 15:86110540-86110562 CTGTCTCAGGGGTGGCAGAGGGG + Intergenic
1131361081 15:91791227-91791249 CTTTCTCAGCTGGGGCTCAGGGG - Intergenic
1132346345 15:101111377-101111399 CCCTCTAGGCAGGGGCAAAGAGG - Intergenic
1132862918 16:2080321-2080343 CTGGGTCAGCAGGGGCACATAGG - Exonic
1132980772 16:2737783-2737805 CAGTCTCAGCAGGGGGATGGAGG + Intergenic
1134739371 16:16529150-16529172 CTGTTCCAGGAGGGGCAAGGTGG + Intergenic
1134928129 16:18183001-18183023 CTGTTCCAGGAGGGGCAAGGTGG - Intergenic
1135048974 16:19177135-19177157 TTGTGTAAGCAGGGGCAAGGGGG + Intronic
1135295372 16:21275116-21275138 CTGTCTTACCAGGGGCAATGTGG + Intronic
1135497874 16:22968415-22968437 CTGTCTCTGCTGGGGCACTGGGG + Intergenic
1138845679 16:60562945-60562967 CTGTCTCAGAAGGATGAAAGGGG - Intergenic
1139429605 16:66904114-66904136 CTGCCTCAGCAGGGGGAATCTGG + Intergenic
1139738112 16:69010553-69010575 CTGTGACAGCAGAGGCAAGGTGG - Intronic
1139751369 16:69110773-69110795 CTGCCTCAGCAATGGCAACGTGG + Intronic
1141157816 16:81609529-81609551 CTGTCTCCCCAGGGGCTGAGGGG - Intronic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141416478 16:83879380-83879402 CTGTCTCAGCAAGGGGAATGCGG + Intergenic
1141949526 16:87331653-87331675 CTGTCTCTGCAGGGGCAGCTGGG + Intronic
1142178927 16:88657820-88657842 CTGCCTCAGGAGGGGCACAGAGG + Intronic
1142349074 16:89571485-89571507 CTGGCTCAGGAGGGCCAAAGGGG + Intergenic
1143917800 17:10306776-10306798 CAGTCTCAGCAGTGGCAAAGTGG - Intronic
1147685383 17:42283913-42283935 CTGTCCAAGCAGAGGCAAGGTGG + Intergenic
1147740386 17:42668027-42668049 CTGTCCCTGCAGGGCCAAAAGGG + Exonic
1148955916 17:51353517-51353539 GTGCCTCAGCAGTGGGAAAGAGG + Intergenic
1149103184 17:52930004-52930026 AAGTCTCAGCAGGTGCAAAGGGG + Intergenic
1151576320 17:74954171-74954193 CTGGCTCTGCAGGGGCAGCGGGG + Exonic
1151777361 17:76214713-76214735 CTGATTAAGAAGGGGCAAAGGGG - Intronic
1152914442 17:83026151-83026173 CTGGCTGAGCAGGAGCAAAGGGG - Intronic
1154375757 18:13808408-13808430 CTGGCACAGCAGGGGAAAAAGGG + Intergenic
1156474617 18:37397776-37397798 CAGTCTCAGCTGGGGTAGAGTGG + Intronic
1156804835 18:41165383-41165405 ATGTCTCAGGAGTGGCAAAAAGG + Intergenic
1157807285 18:50667647-50667669 CTGTCTCAGCCAGGGAGAAGGGG - Intronic
1159150677 18:64519312-64519334 CTATTTCAGCAAGGGCAAAATGG + Intergenic
1163274189 19:16272717-16272739 CTGTCTCAGCATGGCCAGCGGGG + Intergenic
1163314605 19:16533214-16533236 CTGGCTCAGCAGGGGCGGGGTGG + Intronic
1164063541 19:21695167-21695189 CTCTCTCAGCAGGAGGAGAGGGG + Intergenic
1164631447 19:29764420-29764442 GTGTCTCAGTAGGGGCTCAGAGG - Intergenic
1164809682 19:31146445-31146467 CTGTCTCAGCAGGGGCAGCTTGG - Intergenic
1165261456 19:34622668-34622690 CTTTCTCAGTTGGGGCACAGAGG + Intronic
1165900613 19:39167642-39167664 CTGTCTCAGCTGGTCCCAAGAGG - Intronic
1168691670 19:58381105-58381127 CTTTCTCCGCAGCGTCAAAGCGG - Intergenic
925658493 2:6177427-6177449 CTGTCTCAGGGGTGGCAGAGGGG - Intergenic
928167425 2:28981355-28981377 CTGTCTGAGCAGGGGCTGGGTGG - Exonic
928897061 2:36278136-36278158 CTGACTCACCAAGGGCAAAAAGG + Intergenic
929419690 2:41777986-41778008 CTATGCCAGCAGGGGCAAGGAGG + Intergenic
935578598 2:104736210-104736232 CAGTCTCTGCTGAGGCAAAGCGG - Intergenic
936902859 2:117503803-117503825 GTGTCTGAGCAGCAGCAAAGTGG + Intergenic
937238102 2:120442652-120442674 CTGTCCCAGTGGGGGCAGAGTGG - Intergenic
937494209 2:122400755-122400777 CTGTTTCAGAAGGGCCTAAGTGG + Intergenic
938391980 2:130914112-130914134 CTGTCCCAGCAGAGTGAAAGTGG + Intronic
938488570 2:131742829-131742851 CTGTCACAGAAGGAGCAAGGGGG + Intronic
940333735 2:152503055-152503077 CTGTATCAGGAGGGACAAAATGG + Intronic
940533876 2:154913722-154913744 CTGTCTCAGGAGGGGAAATCTGG + Intergenic
941145685 2:161841363-161841385 CTGTGTCAGCAGGGGCATGGTGG - Intronic
944098433 2:195995569-195995591 CTGGCTCAGCAGGGGAAGATGGG + Intronic
944286090 2:197951376-197951398 CTGTCTTACCAGGGCCACAGTGG + Intronic
944881969 2:204022553-204022575 CTGTCTCAACATGGGCTCAGGGG - Intergenic
947729655 2:232420882-232420904 CTGCCTGAGCAGGAGCGAAGCGG + Intergenic
947885834 2:233570277-233570299 CTGTTTCAGGAGTGGCAGAGGGG - Intergenic
948184289 2:236007749-236007771 CTGTCTCAGGAGGGCTAAGGTGG + Intronic
948394195 2:237632433-237632455 CTGTCCCAGCAGGGGCATGAGGG - Intronic
948710106 2:239820026-239820048 CAGGGTCTGCAGGGGCAAAGGGG + Intergenic
1168842254 20:916962-916984 CTGTGTCTCCAGAGGCAAAGTGG - Intergenic
1170589513 20:17761235-17761257 CAGGCTCAGTAGTGGCAAAGGGG + Intergenic
1171879591 20:30608507-30608529 CTGAATCAGCAGGAGAAAAGAGG + Intergenic
1172337356 20:34128315-34128337 CTATCTCAGCAAGGGGAATGTGG - Intergenic
1174087771 20:48021185-48021207 CTCTCTCAGCTGGAGCACAGGGG + Intergenic
1174859283 20:54075243-54075265 CTGTCTCAGCTGGAGCAGGGTGG - Intergenic
1175057559 20:56211977-56211999 CTATCTCAGCAAGGGGAATGCGG + Intergenic
1175618689 20:60424801-60424823 CTGTCCCGGCAGGAGCCAAGAGG - Intergenic
1176305551 21:5121293-5121315 TTGTCTGAGCAGGGACAAAGGGG + Intronic
1176305897 21:5122989-5123011 CTGTCTCAGAGGGTGCAGAGTGG + Intronic
1176947685 21:15003600-15003622 CTGTCTCAGCAAGGTCGAACGGG + Intronic
1179085106 21:38209182-38209204 CTGGAGCAGCAGGAGCAAAGGGG + Intronic
1179292547 21:40031253-40031275 GTCACTCAGCAGGGACAAAGAGG - Intronic
1179851160 21:44139042-44139064 CTGTCTCAGAGGGTGCAGAGTGG - Intronic
1179851505 21:44140738-44140760 TTGTCTGAGCAGGGACAAAGGGG - Intronic
1180081867 21:45490824-45490846 CTGTCTCTCCAGGGGCCAAAGGG + Exonic
1180289887 22:10839271-10839293 CTGTCACAGAAGGAGCAAGGGGG + Intergenic
1180492684 22:15868693-15868715 CTGTCACAGAAGGAGCAAGGGGG + Intergenic
1180736929 22:18024323-18024345 CTGCCTCGGCAGGGGCAGGGTGG + Exonic
1181535217 22:23538513-23538535 CTATCTCAGCAAGGGGAATGCGG - Intergenic
1182066869 22:27437128-27437150 GGGCTTCAGCAGGGGCAAAGGGG - Intergenic
1182430506 22:30296014-30296036 ATGCCTGGGCAGGGGCAAAGGGG + Intronic
1182486309 22:30641153-30641175 CTTTCTCAGCAGGGGCAGCATGG - Intronic
1183067302 22:35371964-35371986 ATTACTCAGCAGGGGCAGAGCGG - Intergenic
1183656071 22:39185446-39185468 TGGGCTCAGCAGGGGCAAGGAGG + Intergenic
1185297290 22:50060690-50060712 CTGTCACAGCAGCGGCCACGTGG + Exonic
949948893 3:9212986-9213008 CTGCATCAGCAGGGGGAAATGGG - Intronic
950631628 3:14285849-14285871 CTGTCCCAGGAAGGGCTAAGAGG - Intergenic
952788152 3:37176256-37176278 CTGTCTCAGCCGCGGCGCAGAGG - Intronic
954444570 3:50539822-50539844 CTGGCTCAACAAGGGCACAGCGG - Intergenic
955603726 3:60676193-60676215 CTGTATCTGCATGGCCAAAGTGG + Intronic
956741844 3:72281489-72281511 CTTCCTCAGCAGGGGCTGAGGGG + Intergenic
958761640 3:98316329-98316351 CTATCTCAGCAAGGGGAAAGTGG + Intergenic
959212807 3:103410283-103410305 CTCTGCCAGCAAGGGCAAAGGGG - Intergenic
959932484 3:111999303-111999325 CTGGCCCAGCAGCAGCAAAGAGG - Exonic
960041205 3:113151591-113151613 CTGGCTCAGCAGGGGCCCAGTGG - Intergenic
961173453 3:124815495-124815517 CTGACTCAGCAGGAGGCAAGCGG + Intronic
961672864 3:128547638-128547660 CAGTCTCAACAGGAGCAAGGCGG + Intergenic
962128685 3:132649576-132649598 CTGTCTCAGCAAGAGCAATGTGG - Intronic
962139308 3:132771830-132771852 GTGTCTCTGAAGGGGCAATGAGG + Intergenic
962360400 3:134737688-134737710 CTGAATCTGCAGGGGCAATGTGG + Intronic
963707290 3:148703185-148703207 GTGTCTCAACAGGGGGAATGAGG - Intronic
964670074 3:159215276-159215298 CTGTCTCTGAAGAGGAAAAGAGG - Intronic
964747182 3:160023342-160023364 CTGACTCCCCAGGGGCAAGGTGG + Intronic
965818240 3:172658789-172658811 CAGTCTCAGGAAGGGCAAAAAGG + Intronic
968396325 4:241979-242001 CTATCTCAGCAAGGGGAATGTGG - Intergenic
968767351 4:2479706-2479728 CTGTCTCAGCAGCGTGAAAACGG + Intronic
971859700 4:32087999-32088021 CTTCCTCAGTTGGGGCAAAGAGG + Intergenic
972850011 4:43036579-43036601 CTTTATCAGCAGGGGGAAAATGG + Intergenic
973700013 4:53527746-53527768 GAGCCTCAGCAGGGGAAAAGGGG + Intronic
975389814 4:73802897-73802919 CTGTAGCAGCAGTGGAAAAGGGG - Intergenic
980530445 4:134046181-134046203 CTATCTCAGCAAGGGGAATGGGG + Intergenic
981915349 4:150026987-150027009 CTGCATCAGCAGTGGCAAAAGGG + Intergenic
982070358 4:151688846-151688868 CTGTCTCAGAGGAGGCAGAGGGG - Intronic
982155277 4:152514193-152514215 CTGTCTCAGAAGAAGCTAAGTGG + Intronic
984591124 4:181618930-181618952 GTGGATCTGCAGGGGCAAAGTGG - Intergenic
984594904 4:181655940-181655962 CTGTTACAGTAGGGACAAAGAGG - Intergenic
985307323 4:188557814-188557836 CTGTCTCAGGGGTGGCAGAGAGG - Intergenic
985762656 5:1758648-1758670 TTGACTCAACAGGGGTAAAGGGG + Intergenic
986087751 5:4468612-4468634 CTGACTCAGCAGGAGGAGAGAGG - Intergenic
987870866 5:23614996-23615018 CTGCCTCAACAGGGGCAGACAGG + Intergenic
989253387 5:39341188-39341210 CTGTCTCTGCAGGGGGGACGGGG + Exonic
991499406 5:67261864-67261886 CTGTCTCTGGAGTGGCAGAGGGG + Intergenic
994534106 5:101006386-101006408 CTATCTCAGCAAGGGGAATGCGG + Intergenic
995035056 5:107524292-107524314 CTGTCCCAGTAGGAGCAATGAGG + Intronic
996001392 5:118368657-118368679 ATGTCTCAGCAGGGGCCAGGTGG - Intergenic
997422175 5:133778465-133778487 CTTTCTTTGCAGAGGCAAAGTGG + Intergenic
997638200 5:135430542-135430564 CCGTCTCAGTAGGTGCGAAGTGG - Intergenic
997903844 5:137794926-137794948 CTGGCTAAGCAGGGGAGAAGTGG - Intergenic
997913692 5:137902390-137902412 CTGTCTCAGGGGTGGCAGAGCGG - Intronic
999030726 5:148288211-148288233 CCGAGTCAGCAGGGGCAAGGAGG - Intergenic
1000698796 5:164422215-164422237 CTGCAGCAGCAGGGGCACAGGGG + Intergenic
1002706091 5:181161509-181161531 CCCTCTCAGCAGGGGCCAACTGG - Intergenic
1003233370 6:4274584-4274606 CTGTCTCAGCAGGGTTCATGTGG + Intergenic
1005042726 6:21613872-21613894 CTGTCTCATCAGAGGCAAAAAGG + Intergenic
1005430205 6:25748679-25748701 CTGTCTCAGCAAGAGGAATGTGG + Intergenic
1005504294 6:26456753-26456775 CTGTCACAGCAGAGACACAGTGG + Intergenic
1006465287 6:34190268-34190290 CTGTCTCATCAGCGGCAAGATGG - Intergenic
1007572439 6:42902830-42902852 CTATCTCAGCAAGGGGAATGTGG + Intergenic
1007710128 6:43817558-43817580 CTTTCTCAGGTGGGACAAAGTGG - Intergenic
1008294143 6:49756256-49756278 CTCTCTCTGCAGTGGCAGAGAGG + Intergenic
1009535984 6:64886697-64886719 CTGTATAACCAGGGGCACAGAGG + Exonic
1010519619 6:76817601-76817623 CTGTGTCTGCAGGGGCAGGGAGG - Intergenic
1012310045 6:97712437-97712459 CTGTCACAGCAGAGGCCATGGGG + Intergenic
1014495901 6:122122128-122122150 CTGTCTCAGAAAGGGAGAAGAGG + Intergenic
1014496187 6:122126236-122126258 CTGTCTCAGAAAGGGAGAAGAGG + Intergenic
1016144052 6:140647589-140647611 CTGAGGCAGCAGGGGCCAAGTGG + Intergenic
1018907418 6:168083643-168083665 CTGTCTCCCAAGGGGCAGAGGGG - Intergenic
1019404032 7:873515-873537 CTGCCTCTGCAGGTGCAGAGGGG + Exonic
1020398404 7:7745239-7745261 CTGTCTCAGGAGTGGCAGAGGGG + Intronic
1020413962 7:7924698-7924720 CAGTTGCAGCAGGGACAAAGGGG + Intronic
1020747645 7:12097995-12098017 CTCTCTCTGCAGTGGCACAGTGG - Intergenic
1021972765 7:25981664-25981686 CTGTCTTAGCAAAGGGAAAGAGG - Intergenic
1022844737 7:34198608-34198630 CAGTCACAGCAGTGGCAAAGCGG + Intergenic
1023475164 7:40569568-40569590 TTGGCACAGCTGGGGCAAAGAGG + Intronic
1027606835 7:80310873-80310895 CTGTTTCAACAGTGGCAATGTGG + Intergenic
1028164763 7:87525733-87525755 CTGTCTCAGGGGTGGCAGAGGGG + Intronic
1028522974 7:91752720-91752742 CAGTCCCAGCAGGGGAAAAATGG - Intronic
1029645712 7:101854560-101854582 CTGGCTGAGCAGTGGCCAAGAGG - Intronic
1031484023 7:122307141-122307163 TTGTCTGAGCAGGGGAAAGGAGG - Intronic
1031837119 7:126691375-126691397 CTGATCCTGCAGGGGCAAAGGGG + Intronic
1034567677 7:151928788-151928810 ATTTCTGAGCTGGGGCAAAGTGG + Intergenic
1035422764 7:158742905-158742927 CAGTCTCTGCCGGGGCAAGGAGG + Intronic
1036744247 8:11392889-11392911 CTGTTTCTGCAGGTGCTAAGGGG + Intronic
1037399923 8:18485560-18485582 CAGTCCCAGCAGGGTCAGAGTGG + Intergenic
1037684313 8:21125378-21125400 CTTTCTCCCCAGGGGCAAGGGGG + Intergenic
1037918509 8:22787598-22787620 CTGCGTAAGCAGTGGCAAAGAGG - Intronic
1038425054 8:27459567-27459589 CTGTCCCTGCAAGGGCAAAAGGG - Intergenic
1040478423 8:47801840-47801862 CTGTCACATCATGGGCAAGGAGG - Intronic
1042504879 8:69549378-69549400 CTATCACAGTAGGGGAAAAGAGG - Intronic
1045282164 8:100758554-100758576 CTGTCTCTTCAGTGGCAAAATGG + Intergenic
1047406065 8:124586715-124586737 CTGTCTGCACAGGGGCCAAGAGG - Intronic
1048080545 8:131121875-131121897 CTCTCTCAGCAGAGGCAGAAGGG + Intergenic
1048281555 8:133109276-133109298 CTGACTCAGCAGGTCCAGAGTGG - Intronic
1048902139 8:139049080-139049102 CTATCTCAGCAAGGGGAATGCGG + Intergenic
1048902344 8:139050906-139050928 CTATCTCAGCAAGGGGAATGCGG - Intergenic
1049863490 8:144917512-144917534 CTGTCTCAAAACGGGCACAGTGG + Intergenic
1051640932 9:19223992-19224014 CTGTCTCAGCATTATCAAAGTGG - Intergenic
1052996630 9:34554647-34554669 CTGTCTCAGCATGGACAAGAGGG - Intronic
1053614112 9:39745476-39745498 CTGTCTAGGCAGGGGGCAAGGGG + Intergenic
1053872142 9:42503418-42503440 CTGTCTAGGCAGGGGGCAAGGGG + Intergenic
1054239405 9:62596917-62596939 CTGTCTAGGCAGGGGGCAAGGGG - Intergenic
1054553536 9:66631444-66631466 CTGTCTAGGCAGGGGGCAAGGGG - Intergenic
1055028862 9:71751628-71751650 CTGGCTCAGCTGGTGCAAACAGG + Intronic
1056340601 9:85627657-85627679 CTGTCTCAGCAGGGGCAAAGGGG - Intronic
1056852454 9:90095937-90095959 GTGTCTCAGCAGCGACAGAGCGG - Intergenic
1057480377 9:95440607-95440629 CTGTCTCAGGATTGGCAGAGGGG + Intergenic
1058401428 9:104624410-104624432 CTTTATCAGCAGGGGGAAAACGG + Intergenic
1059705198 9:116816446-116816468 CTTCTCCAGCAGGGGCAAAGAGG - Intronic
1060309678 9:122448123-122448145 CTATCTCAGCAAGGGGAATGCGG + Intergenic
1060428146 9:123523971-123523993 CTGTTTCAGCAGGCACAAAAGGG - Intronic
1060527721 9:124329866-124329888 GTGACTCAGGAGGGGCACAGGGG + Intronic
1060917276 9:127398615-127398637 CTGGGTCAGGAGGGGGAAAGGGG - Intronic
1062147317 9:134996846-134996868 CTGTCTCAGCAGCTGCGAGGTGG + Intergenic
1185715397 X:2337986-2338008 TTGTCTCAGCTGAGGCACAGCGG - Intronic
1187038772 X:15570711-15570733 CTGTCCAAGCAGGGGCACAAGGG - Intronic
1187403177 X:18980635-18980657 CTATCTCAGCAAGGGGAATGCGG - Intronic
1188514903 X:30974787-30974809 CGGTGTCAGCTGGGGCAATGTGG - Intronic
1190220563 X:48509761-48509783 CTGTCAAAGCAGGGACACAGAGG - Exonic
1191018442 X:55835407-55835429 CTATCTCAGCAAGGGGAATGTGG + Intergenic
1192235854 X:69295519-69295541 ATGCCTCAGCTGGGGCAGAGTGG - Intergenic
1195215622 X:102698555-102698577 CTGTCTTAGCAGGGATAAACTGG + Intergenic
1196703830 X:118699276-118699298 TTGTCACAACTGGGGCAAAGAGG + Intergenic
1197146840 X:123181418-123181440 CTGAGCCAGCAGGGGCACAGTGG - Intergenic