ID: 1056340876

View in Genome Browser
Species Human (GRCh38)
Location 9:85630721-85630743
Sequence CTTTGTCAGGCCAAGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115076
Summary {0: 1, 1: 22, 2: 1632, 3: 28577, 4: 84844}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056340876_1056340884 -6 Left 1056340876 9:85630721-85630743 CCATCCACCTTGGCCTGACAAAG 0: 1
1: 22
2: 1632
3: 28577
4: 84844
Right 1056340884 9:85630738-85630760 ACAAAGTGCTGGGATTAGAGGGG No data
1056340876_1056340885 12 Left 1056340876 9:85630721-85630743 CCATCCACCTTGGCCTGACAAAG 0: 1
1: 22
2: 1632
3: 28577
4: 84844
Right 1056340885 9:85630756-85630778 AGGGGTGAGCTACTGCACCCAGG No data
1056340876_1056340883 -7 Left 1056340876 9:85630721-85630743 CCATCCACCTTGGCCTGACAAAG 0: 1
1: 22
2: 1632
3: 28577
4: 84844
Right 1056340883 9:85630737-85630759 GACAAAGTGCTGGGATTAGAGGG No data
1056340876_1056340882 -8 Left 1056340876 9:85630721-85630743 CCATCCACCTTGGCCTGACAAAG 0: 1
1: 22
2: 1632
3: 28577
4: 84844
Right 1056340882 9:85630736-85630758 TGACAAAGTGCTGGGATTAGAGG No data
1056340876_1056340886 19 Left 1056340876 9:85630721-85630743 CCATCCACCTTGGCCTGACAAAG 0: 1
1: 22
2: 1632
3: 28577
4: 84844
Right 1056340886 9:85630763-85630785 AGCTACTGCACCCAGGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056340876 Original CRISPR CTTTGTCAGGCCAAGGTGGA TGG (reversed) Intronic
Too many off-targets to display for this crispr