ID: 1056346756

View in Genome Browser
Species Human (GRCh38)
Location 9:85704297-85704319
Sequence GGAGGCTTTCTGCACATCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 193}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056346756_1056346760 11 Left 1056346756 9:85704297-85704319 CCAGAGATGTGCAGAAAGCCTCC 0: 1
1: 0
2: 1
3: 17
4: 193
Right 1056346760 9:85704331-85704353 AGCTGAATACAGATCAGCGCAGG No data
1056346756_1056346761 20 Left 1056346756 9:85704297-85704319 CCAGAGATGTGCAGAAAGCCTCC 0: 1
1: 0
2: 1
3: 17
4: 193
Right 1056346761 9:85704340-85704362 CAGATCAGCGCAGGAGTGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056346756 Original CRISPR GGAGGCTTTCTGCACATCTC TGG (reversed) Intronic
903060857 1:20667660-20667682 GAAGGCTTTCTCCACATGGCCGG - Intronic
903490945 1:23728050-23728072 TGGGGCTGTCTGCACATCTCAGG + Intergenic
904928996 1:34071556-34071578 GGAGGCTTTCTGCCCAGACCTGG + Intronic
905859482 1:41340383-41340405 GGGGGCTCTCTGCAGATCTTTGG + Intergenic
906993469 1:50764383-50764405 TGATGCTTTCTGCAAATCTTTGG - Intronic
909037943 1:70615946-70615968 AGAGGCTTTCTGCATATCACAGG + Intergenic
909568974 1:77086740-77086762 GGCTCCTTCCTGCACATCTCTGG + Intergenic
914308421 1:146444003-146444025 GGCGGGTTTCTGCACGGCTCCGG - Intergenic
915897335 1:159822485-159822507 GCAGGCTTCCTTCAAATCTCTGG + Intergenic
916167539 1:161977341-161977363 GGAGACTTTAAGCACCTCTCAGG + Intergenic
916316395 1:163453051-163453073 GATGGCTTTATCCACATCTCAGG - Intergenic
918612465 1:186508624-186508646 GGAGGCCTTCTCCGCATCTATGG + Intergenic
919597068 1:199577584-199577606 TCAGGCTTTCTGCATATTTCTGG + Intergenic
919725114 1:200877160-200877182 GGAGCATGCCTGCACATCTCAGG + Intergenic
920457167 1:206110126-206110148 GGAGGTTCTCTGCCCACCTCGGG - Exonic
923223523 1:231917706-231917728 GCAGGCTCTCTGCCCATCTTGGG - Intronic
1063935271 10:11071215-11071237 GGAGGCTTGCTGCAAAACACAGG - Intronic
1065669548 10:28100702-28100724 TGAGTCTTTCAGCTCATCTCAGG + Intronic
1069605585 10:69736953-69736975 GGAGGCTTTCTGGAAACCTCTGG - Intergenic
1069878485 10:71577535-71577557 GGAAGGTTGCTGCACCTCTCTGG - Intronic
1072440030 10:95446252-95446274 GGATGCTTTCTTAACAACTCTGG - Intronic
1073333311 10:102685600-102685622 GGAAGCTTGCTGCACATGTGGGG + Intronic
1073532299 10:104243814-104243836 TGAGGCTTTCTGCCCTTTTCTGG + Intronic
1074059771 10:109954354-109954376 GGAGTCTTTTTGCAGATATCAGG - Intergenic
1074521095 10:114224855-114224877 AGAGGCTTTCTGCAAATCTCTGG + Intronic
1074674933 10:115837324-115837346 GGATGCTTTTTGCAGGTCTCTGG - Intronic
1075548972 10:123378209-123378231 GGCTGCTTTCTGGAGATCTCAGG + Intergenic
1075979959 10:126729601-126729623 GAAGGCTTTGTGCAGATGTCTGG - Intergenic
1076012950 10:127004948-127004970 GGTGGCATTCAGCACATCTGGGG + Intronic
1077713400 11:4557926-4557948 GGAGACTTACTTCCCATCTCTGG + Intergenic
1078675404 11:13407988-13408010 GGAGGCTTTATTCACATGTCTGG - Intronic
1078727609 11:13945655-13945677 GCATGGTTTCTGTACATCTCGGG + Intergenic
1081493562 11:43584353-43584375 GAAGGCTTTGTGGGCATCTCTGG + Intronic
1081583210 11:44366512-44366534 GGGGGCTTTCTGCCAGTCTCTGG + Intergenic
1081617613 11:44600002-44600024 GGAGGCCATCTGGACATCTCTGG + Intronic
1081693954 11:45096597-45096619 GGAGGCTTTAGGAACATCTGAGG - Intronic
1088521388 11:110704756-110704778 GCAGGCTTTCTGAACACATCAGG + Intronic
1089129621 11:116201441-116201463 AGAGGCTTTCTGGAAATGTCTGG - Intergenic
1091208948 11:133840715-133840737 GGAGTCTTTCTGCCCAGGTCTGG + Exonic
1092081613 12:5721020-5721042 GGACGCATTCTACACATCTCTGG + Intronic
1092962904 12:13613154-13613176 AGAGGTTTTCTCCACACCTCTGG - Intronic
1094699977 12:32860266-32860288 GCAGGTCCTCTGCACATCTCAGG - Intronic
1097283236 12:57858748-57858770 GGAGGCTTTCTTCAGAGGTCTGG + Intergenic
1100391938 12:94150988-94151010 GGAGCCATTGTGCACTTCTCCGG + Intronic
1101815781 12:108145088-108145110 GGAGACTTTCTTGACCTCTCTGG + Intronic
1103902576 12:124311106-124311128 GGGGGCTGTCTCCACAGCTCTGG + Intronic
1105884544 13:24630535-24630557 GGGGGCTTTCAGCACAGCGCAGG + Intergenic
1105980789 13:25514386-25514408 GCAGGCTTTCTACACATATTTGG + Intronic
1106501305 13:30331553-30331575 AGAGCCCTTCAGCACATCTCTGG + Intergenic
1106503665 13:30353118-30353140 AGAGGCTTTCTTCAAATGTCTGG - Intergenic
1109702376 13:66043531-66043553 GGAGGCATTCTGAAACTCTCAGG - Intergenic
1112388900 13:98964826-98964848 GGAGGCCTGCTGCTCACCTCAGG - Intronic
1112615666 13:101002650-101002672 GCAGGCTTTCTTCAGATTTCTGG + Intergenic
1112638509 13:101245039-101245061 CAAGGCTTTCTGCAAATCCCAGG + Intronic
1112825973 13:103393024-103393046 GGAGGCTTCCTCTGCATCTCCGG - Intergenic
1113469496 13:110534346-110534368 GGAGGCTGTCTGCAAAGCTGAGG + Intronic
1113566835 13:111324382-111324404 GGAGGCTTCCAGCACTTCTGAGG - Intronic
1114337969 14:21712694-21712716 GGAGTCTTGGTGCACATCCCGGG - Intergenic
1117918833 14:60706425-60706447 ATAGGTTTTCTGCACATCACTGG + Intergenic
1118400214 14:65372880-65372902 GGAGGCTTTCCTCACATACCTGG + Intergenic
1119917479 14:78415518-78415540 GGAGCCTTCCTGTACATCCCAGG - Intronic
1124962146 15:34406715-34406737 AGAGGCTTTCAGCACAGCCCAGG - Intronic
1124978769 15:34552936-34552958 AGAGGCTTTCAGCACAGCCCAGG - Intronic
1130838631 15:87676171-87676193 GGAGGCTTTCTGCAGGTATCTGG - Intergenic
1131443072 15:92473373-92473395 AGAGGCTTCCTGCACCACTCTGG - Intronic
1132164102 15:99567109-99567131 GGAGGCTCGCTTCACAGCTCCGG - Intronic
1132286911 15:100670026-100670048 GGAGGGTTTCTGGAGATCTTTGG + Intergenic
1133890412 16:9874086-9874108 GGAGTCTTTCTTCACATCCAGGG + Intronic
1134369029 16:13606441-13606463 TGAGGCTTTCTTCCCTTCTCTGG - Intergenic
1135926401 16:26697677-26697699 GGAGAGTTTCTTCACTTCTCTGG - Intergenic
1136067072 16:27766550-27766572 GGAGGATTTATGCTCCTCTCTGG - Intronic
1138995845 16:62452054-62452076 TGAGGCTTTCTTCACTTTTCCGG + Intergenic
1139573290 16:67826407-67826429 GGAGGATATCAGCTCATCTCTGG - Intronic
1139675297 16:68519401-68519423 GAAGCCTTTCTGCCCAGCTCAGG + Intergenic
1141680214 16:85539350-85539372 GGCGGCTCTCTGCAGATTTCAGG + Intergenic
1141922703 16:87146640-87146662 GGTGGCTTTGTTCACATGTCTGG + Intronic
1142365110 16:89646013-89646035 GGAGCCTTCCAGCACATCACGGG + Exonic
1144088892 17:11835638-11835660 GGCAGCTTTCTGTCCATCTCTGG - Intronic
1146478798 17:33185671-33185693 GGAGACCTTCTGCAGATCTCTGG - Intronic
1148872710 17:50668218-50668240 GGAGGCTATCTACAGAACTCAGG - Intronic
1149275706 17:55032973-55032995 GGAGGATTTCTCCAAATCTCTGG - Intronic
1150443814 17:65212998-65213020 GGAGGCTTTCTCCAAATCCAGGG - Intronic
1152719318 17:81915117-81915139 GGAGGCTTATAGGACATCTCTGG - Intronic
1152939603 17:83161266-83161288 GGAGGCTTTCTTCTCACATCAGG + Intergenic
1153351471 18:4085027-4085049 GGAGGTTTTCTGTACTTCTGTGG + Intronic
1153464985 18:5379057-5379079 TGAGGTTTTCTGGACTTCTCTGG - Intergenic
1155396752 18:25393883-25393905 GGGGACTCTCTGCAGATCTCTGG - Intergenic
1156249517 18:35338994-35339016 GCAGGTTTTCTTCACATCTGAGG - Intronic
1157716873 18:49894035-49894057 TGAGGCTTTCTGCACATGCTTGG + Intronic
1158714328 18:59864273-59864295 GGAGTCTTTCTGCATATTCCAGG + Intergenic
1160072195 18:75638830-75638852 GGAGGCTGCCAGCAAATCTCAGG + Intergenic
1160394298 18:78560221-78560243 GGAGGCCGTCTGGAGATCTCAGG - Intergenic
1165193766 19:34085376-34085398 GGAGGCTTTATGCAGACCTCAGG + Intergenic
1165710004 19:38004301-38004323 TGAGGCTTTCTTCAGGTCTCTGG - Intronic
1166224175 19:41384689-41384711 TGGGACTTTCTGCACACCTCAGG + Intronic
1168679150 19:58301128-58301150 GGGAGCTTTCGGCACACCTCGGG - Exonic
925691066 2:6523747-6523769 GGAGCCTTTTTTCGCATCTCAGG - Intergenic
926654051 2:15379813-15379835 GAAGGCTTTCTGTAAATATCTGG + Exonic
928905710 2:36365349-36365371 TGAGGATTTCTGGACATCACTGG + Intronic
929648370 2:43652744-43652766 AGAGGCTTTCTTCAGATGTCTGG - Intronic
930713868 2:54574482-54574504 GGATGCTTTCTGCGCAGCTAGGG - Intronic
931294494 2:60908036-60908058 GAAGGCTTTCAGGGCATCTCAGG - Intronic
931936805 2:67207318-67207340 TGAGGTTTTCTGCAGAGCTCAGG + Intergenic
932559908 2:72857942-72857964 GGAGGGTTTCTTCAAATGTCTGG - Intergenic
935118369 2:100157977-100157999 GGAGACCTTCTGAACATCCCTGG - Intergenic
936857683 2:116980060-116980082 GCTGGCTTTCTCCACTTCTCTGG + Intergenic
939991020 2:148876487-148876509 GGAGGCTGTGTCCACATCTGTGG + Intronic
941021215 2:160408782-160408804 GGAGGCCTTCTGCACTGCACAGG - Intronic
941580900 2:167294004-167294026 GGAGGCTTGCTACACTTTTCTGG + Intergenic
946396726 2:219447218-219447240 GGGGGCCTTCTGTACTTCTCAGG + Intronic
947808484 2:232984508-232984530 GAAGGCTGTCTTCACATCACAGG - Intronic
948661700 2:239511049-239511071 GGGGGCCTTCTGCAGCTCTCTGG + Intergenic
1168812585 20:715288-715310 GGGGACTTTCTTCATATCTCTGG + Intergenic
1170473033 20:16687237-16687259 GTATGCTTTCAGCAAATCTCGGG + Intergenic
1171265950 20:23772613-23772635 GGAGGCTTTCTTCACAGCAGGGG - Intergenic
1173544546 20:43884788-43884810 GGAGGTTTTCCTCACATGTCTGG + Intergenic
1173547412 20:43909487-43909509 GGATGCTTCCTGCCCACCTCTGG - Intergenic
1173674643 20:44823128-44823150 GGAGGATTCCTGCAGATGTCTGG + Intergenic
1174113599 20:48212606-48212628 GGAGGATGTCTGCTCACCTCCGG + Intergenic
1174168251 20:48599918-48599940 GGAGGATGTCTGCTCACCTCTGG - Intergenic
1176121680 20:63456907-63456929 GCTGGCTTTCTGCTCATCCCCGG - Intronic
1178275603 21:31234100-31234122 GGGGGCTTTCAGCAAATGTCTGG - Intronic
1179025945 21:37678500-37678522 GGAGGCTTTCTGGGTATTTCTGG - Intronic
1179976203 21:44868583-44868605 GGAGTCTTTCTGGCCATATCTGG + Intronic
1181333412 22:22112101-22112123 GCAGTAATTCTGCACATCTCTGG + Intergenic
1183010451 22:34942072-34942094 GGAGGCTTCCTGCAGCTCTGGGG - Intergenic
1184679531 22:46062721-46062743 GAAGCCTTTCTGCTCATCTTTGG - Intronic
1185235499 22:49710439-49710461 GGAGGCATTCTCTAAATCTCAGG + Intergenic
951231685 3:20186520-20186542 GGAGGCTTTGAGCACAACCCGGG - Intergenic
952207210 3:31191901-31191923 GGAGTCTTTCTGCATTTCTCTGG + Intergenic
952493824 3:33898508-33898530 AGATGCTTTTTGAACATCTCTGG + Intergenic
953756704 3:45652806-45652828 GGAGACCCTCTGCACATCTCTGG + Intronic
954760421 3:52869852-52869874 GGAGACTTGCTTAACATCTCTGG + Intronic
958260018 3:91369166-91369188 ACAGGGTTTCTGCACATTTCGGG + Intergenic
960316314 3:116182068-116182090 GGAGACTATCTGCACAGATCAGG - Intronic
960372008 3:116852341-116852363 GGAGTCTTTCTGTACAAATCAGG + Intronic
960829302 3:121829417-121829439 GGAGGGTTTCTGCCATTCTCTGG + Intronic
961462534 3:127061660-127061682 TGGGGCTTTCTGCAGATGTCTGG + Intergenic
962437954 3:135383726-135383748 TGAGGCTTTCTGCACTTCCCTGG - Intergenic
962589886 3:136879053-136879075 AGAAGCTTTCTTCACATGTCTGG - Intronic
965683391 3:171275303-171275325 GGAGGCTTTCTTCATATAACTGG - Intronic
968093667 3:195913116-195913138 GCAAGCTTTCAGCACTTCTCTGG - Intergenic
969625209 4:8299690-8299712 AGAGGCTTTTTGTGCATCTCTGG + Intronic
973266262 4:48214295-48214317 GGAGGCTTTGTACACCCCTCTGG - Intronic
975480592 4:74875583-74875605 TGAAGCTTTCTGCATGTCTCAGG - Intergenic
978564750 4:110069994-110070016 GGTGCCTTTCTGTACATCCCTGG + Intronic
979605984 4:122639412-122639434 GGAGGCTTTCAGCACAAGTGTGG + Intergenic
981561892 4:146056942-146056964 GGAGACTTTCCTCACATGTCTGG - Intergenic
982440893 4:155434443-155434465 GAGGGCTTTCTGCATAACTCTGG + Intergenic
982900872 4:161002078-161002100 AGAGGATTTCTGCACACATCTGG - Intergenic
985635801 5:1035452-1035474 GGAGGTTGTCTGCACACGTCAGG + Exonic
986046186 5:4040632-4040654 GGCGACTCTCTGAACATCTCGGG + Intergenic
988594195 5:32576021-32576043 GCATCCTTTCTGCACATCTCGGG + Intronic
992678352 5:79128107-79128129 GGATGCTTTGTAAACATCTCTGG - Intronic
994993707 5:107032030-107032052 GAAAGCTTTCTTCAGATCTCTGG - Intergenic
996138395 5:119873852-119873874 TGAGGCTTTCTTCACTTTTCCGG - Intergenic
997490738 5:134273735-134273757 AGAGGCATTCTGCATTTCTCAGG + Intergenic
1000542729 5:162560270-162560292 GGAGGTATTCTGCACTGCTCTGG - Intergenic
1002956131 6:1866728-1866750 GCAGGCTTTCTGCTCTTTTCTGG - Intronic
1003290720 6:4776415-4776437 GGAAGCTTTCTGCACTACACCGG + Exonic
1005649457 6:27873365-27873387 GGAGGCGTTAAGCGCATCTCAGG - Exonic
1006744649 6:36332811-36332833 AGAGGCCTTCTGAACAACTCTGG - Intronic
1006905932 6:37533584-37533606 GGTGGCTTTCTGCAGAGCACTGG + Intergenic
1007995155 6:46299569-46299591 GAAGGCTTTCTTCCCCTCTCTGG + Intronic
1008995220 6:57651240-57651262 ACAGGGTTTCTGCACATTTCGGG - Intergenic
1009183754 6:60550000-60550022 ACAGGGTTTCTGCACATTTCGGG - Intergenic
1010375975 6:75170826-75170848 TGAGGTTTTTAGCACATCTCAGG - Intronic
1011485721 6:87839511-87839533 GGAGGCTTTCCTCAAATTTCTGG + Intergenic
1011864368 6:91805121-91805143 GGACACTCTCTGCAGATCTCTGG + Intergenic
1011873725 6:91929511-91929533 GGAGACTTTCAGAAGATCTCCGG - Intergenic
1013279525 6:108622635-108622657 GGAGCCTTTCTGCCCCTCTAGGG + Intronic
1014799597 6:125763355-125763377 GGAGGCTTTTTGCTCTTCTTTGG + Intergenic
1016774452 6:147889860-147889882 GGAAACTCTCTGCAGATCTCTGG + Intergenic
1020182903 7:5935986-5936008 GGGAGCCTTCTGCACATGTCTGG + Intronic
1020300009 7:6788771-6788793 GGGAGCCTTCTGCACATGTCTGG - Intronic
1021419715 7:20432150-20432172 GGATTCTATCTGCACATCTCAGG - Intergenic
1021653214 7:22851428-22851450 GGAGGCGTTGTGCACTTCCCTGG - Intergenic
1021792300 7:24217831-24217853 GGCTGCTTTATGCACATGTCTGG - Intergenic
1024269963 7:47634925-47634947 GGAGGCTCTCTGCCCCTCTTAGG + Intergenic
1024605214 7:51017517-51017539 GGTGGGTTTCTGCAATTCTCTGG + Exonic
1026413269 7:70150358-70150380 GTATGCTTTCTACACATCTGAGG - Intronic
1027188790 7:75986354-75986376 GAAGGTGTTCTGCACATCCCTGG - Exonic
1032389621 7:131547410-131547432 GGATGCTTTCTGCACATCAGAGG + Intronic
1035279772 7:157770443-157770465 GGAGGCTTTCTGCTGTTGTCAGG + Intronic
1036392854 8:8339565-8339587 TGAGGCTTTCTGCAGAGCCCTGG + Exonic
1036765527 8:11547389-11547411 GCAGGCTCTCTGCACAGCTCTGG - Intronic
1037499455 8:19471179-19471201 GGAGGCTTTCTTCCCTTTTCCGG - Intronic
1038880199 8:31602478-31602500 GGAGACTCTCTGCAGACCTCTGG + Intergenic
1038972311 8:32649229-32649251 GTGGGCTCTCTGCACATCACAGG - Intronic
1041668749 8:60471545-60471567 GGAGACTATCTACACAACTCTGG + Intergenic
1042241683 8:66670305-66670327 AGAGGCTTTCTACACTCCTCCGG - Intronic
1052299831 9:26941539-26941561 GGAGGCTTTCCCCAGATGTCTGG - Intronic
1053446821 9:38159124-38159146 TGAGGCTTACTCCACAGCTCCGG - Intergenic
1055838288 9:80471991-80472013 GTAGAGTTTCTGCACATTTCAGG + Intergenic
1056346756 9:85704297-85704319 GGAGGCTTTCTGCACATCTCTGG - Intronic
1056721577 9:89076453-89076475 GGACGCTTTCTCCACAATTCAGG + Intronic
1057044721 9:91876549-91876571 GGGAGCTTTCTGCAGATGTCTGG - Intronic
1057346621 9:94257247-94257269 GAGGACTCTCTGCACATCTCTGG + Intergenic
1058423537 9:104856378-104856400 AGGTGCTTTCTGCATATCTCGGG - Intronic
1058610369 9:106769586-106769608 GGAGACATACTGCACGTCTCAGG - Intergenic
1058897951 9:109416246-109416268 GGAGGCTTCCAGCACAGCTTGGG + Intronic
1061592994 9:131610289-131610311 GGAGGCTGTCTGCTCATCAGCGG + Intronic
1061933687 9:133846147-133846169 GGCAGCTTTCTTCACCTCTCTGG - Intronic
1062052367 9:134454240-134454262 AGATGCTTGCTGCACATTTCAGG + Intergenic
1062379351 9:136279689-136279711 GGAAGCTTGCTGCACCTCCCTGG + Intergenic
1187160335 X:16758785-16758807 GGTGGCTTCCTGCACAACACAGG + Intronic
1190625728 X:52336777-52336799 GCAGGCTTTCTTGGCATCTCTGG - Intergenic
1191679390 X:63825696-63825718 AGAGGCACTCTTCACATCTCAGG + Intergenic
1192963516 X:76153683-76153705 TGAGGCTTTCTTCACTTTTCTGG - Intergenic
1199663181 X:150073294-150073316 GGGGACCCTCTGCACATCTCTGG - Intergenic
1199894314 X:152116851-152116873 GGGAGCTATCTGCTCATCTCAGG - Intergenic
1200178351 X:154134367-154134389 GGAGGCTTTTTCCCCTTCTCTGG + Intergenic