ID: 1056353547

View in Genome Browser
Species Human (GRCh38)
Location 9:85775838-85775860
Sequence ATGGTGCACCAGATTGAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056353542_1056353547 25 Left 1056353542 9:85775790-85775812 CCTTCTTATGTTTTTCTGCCTGC No data
Right 1056353547 9:85775838-85775860 ATGGTGCACCAGATTGAGGTTGG No data
1056353544_1056353547 7 Left 1056353544 9:85775808-85775830 CCTGCTTTATATTCATTGGCAGC No data
Right 1056353547 9:85775838-85775860 ATGGTGCACCAGATTGAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056353547 Original CRISPR ATGGTGCACCAGATTGAGGT TGG Intergenic
No off target data available for this crispr