ID: 1056366421

View in Genome Browser
Species Human (GRCh38)
Location 9:85909441-85909463
Sequence CTCACCACTGCTGCTAGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056366421_1056366425 12 Left 1056366421 9:85909441-85909463 CCTCCTCTAGCAGCAGTGGTGAG No data
Right 1056366425 9:85909476-85909498 GCAGATGAACTCTCCACCCCAGG No data
1056366421_1056366429 27 Left 1056366421 9:85909441-85909463 CCTCCTCTAGCAGCAGTGGTGAG No data
Right 1056366429 9:85909491-85909513 ACCCCAGGAGGGTTTTACCATGG No data
1056366421_1056366427 16 Left 1056366421 9:85909441-85909463 CCTCCTCTAGCAGCAGTGGTGAG No data
Right 1056366427 9:85909480-85909502 ATGAACTCTCCACCCCAGGAGGG No data
1056366421_1056366426 15 Left 1056366421 9:85909441-85909463 CCTCCTCTAGCAGCAGTGGTGAG No data
Right 1056366426 9:85909479-85909501 GATGAACTCTCCACCCCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056366421 Original CRISPR CTCACCACTGCTGCTAGAGG AGG (reversed) Intergenic
No off target data available for this crispr