ID: 1056369681

View in Genome Browser
Species Human (GRCh38)
Location 9:85941418-85941440
Sequence GGCTCCCCAGTGCCCGCTGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 221}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056369673_1056369681 8 Left 1056369673 9:85941387-85941409 CCCTCCCGCTGCGCGTCAGGTAG 0: 1
1: 0
2: 0
3: 1
4: 43
Right 1056369681 9:85941418-85941440 GGCTCCCCAGTGCCCGCTGTCGG 0: 1
1: 0
2: 2
3: 19
4: 221
1056369667_1056369681 22 Left 1056369667 9:85941373-85941395 CCCTGCGGCCCCGGCCCTCCCGC 0: 1
1: 0
2: 2
3: 60
4: 533
Right 1056369681 9:85941418-85941440 GGCTCCCCAGTGCCCGCTGTCGG 0: 1
1: 0
2: 2
3: 19
4: 221
1056369677_1056369681 3 Left 1056369677 9:85941392-85941414 CCGCTGCGCGTCAGGTAGGAGCG 0: 1
1: 0
2: 0
3: 6
4: 34
Right 1056369681 9:85941418-85941440 GGCTCCCCAGTGCCCGCTGTCGG 0: 1
1: 0
2: 2
3: 19
4: 221
1056369674_1056369681 7 Left 1056369674 9:85941388-85941410 CCTCCCGCTGCGCGTCAGGTAGG 0: 1
1: 0
2: 0
3: 3
4: 40
Right 1056369681 9:85941418-85941440 GGCTCCCCAGTGCCCGCTGTCGG 0: 1
1: 0
2: 2
3: 19
4: 221
1056369668_1056369681 21 Left 1056369668 9:85941374-85941396 CCTGCGGCCCCGGCCCTCCCGCT 0: 1
1: 0
2: 6
3: 78
4: 531
Right 1056369681 9:85941418-85941440 GGCTCCCCAGTGCCCGCTGTCGG 0: 1
1: 0
2: 2
3: 19
4: 221
1056369676_1056369681 4 Left 1056369676 9:85941391-85941413 CCCGCTGCGCGTCAGGTAGGAGC 0: 1
1: 0
2: 0
3: 4
4: 53
Right 1056369681 9:85941418-85941440 GGCTCCCCAGTGCCCGCTGTCGG 0: 1
1: 0
2: 2
3: 19
4: 221
1056369666_1056369681 30 Left 1056369666 9:85941365-85941387 CCAGGTCACCCTGCGGCCCCGGC 0: 1
1: 0
2: 1
3: 30
4: 365
Right 1056369681 9:85941418-85941440 GGCTCCCCAGTGCCCGCTGTCGG 0: 1
1: 0
2: 2
3: 19
4: 221
1056369669_1056369681 14 Left 1056369669 9:85941381-85941403 CCCCGGCCCTCCCGCTGCGCGTC 0: 1
1: 0
2: 0
3: 26
4: 196
Right 1056369681 9:85941418-85941440 GGCTCCCCAGTGCCCGCTGTCGG 0: 1
1: 0
2: 2
3: 19
4: 221
1056369671_1056369681 12 Left 1056369671 9:85941383-85941405 CCGGCCCTCCCGCTGCGCGTCAG 0: 1
1: 0
2: 2
3: 17
4: 166
Right 1056369681 9:85941418-85941440 GGCTCCCCAGTGCCCGCTGTCGG 0: 1
1: 0
2: 2
3: 19
4: 221
1056369670_1056369681 13 Left 1056369670 9:85941382-85941404 CCCGGCCCTCCCGCTGCGCGTCA 0: 1
1: 0
2: 2
3: 17
4: 139
Right 1056369681 9:85941418-85941440 GGCTCCCCAGTGCCCGCTGTCGG 0: 1
1: 0
2: 2
3: 19
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056369681 Original CRISPR GGCTCCCCAGTGCCCGCTGT CGG Intronic
900363357 1:2300485-2300507 GGGGCCCCAGTGTCAGCTGTCGG - Intronic
900366197 1:2312893-2312915 CCCTCCCCAGGGTCCGCTGTGGG - Intergenic
900367338 1:2316594-2316616 GACTCCCCAGGGCTCGCTGAAGG + Intergenic
900630658 1:3633455-3633477 GGCAGCCCAGTCCCAGCTGTGGG + Exonic
900665292 1:3811056-3811078 GGCTGCCCACTGCCCTCTGCTGG + Intergenic
902082939 1:13833640-13833662 GGGTCCCCAGTGGATGCTGTCGG + Intergenic
902598654 1:17526143-17526165 GGCTCCCCAGTGCCCTCTCTGGG + Intergenic
902639087 1:17755269-17755291 GGCTCCCCAGCGCCCTCTACTGG - Intergenic
904599019 1:31663759-31663781 GGCTCCCCAGTGCCTGTAGCAGG - Intronic
906381015 1:45332204-45332226 GGCTGCACAGTGGGCGCTGTGGG + Exonic
906640439 1:47437968-47437990 GGCTCCGCAGCGCCCCCTGGCGG - Exonic
906708825 1:47914406-47914428 GATTCCGCGGTGCCCGCTGTGGG + Intronic
906726634 1:48049034-48049056 GGCTCCCCACTGCCCCGGGTGGG + Intergenic
907222032 1:52914172-52914194 GGCTCCCCTCTGCCCACTGGAGG - Intronic
908102605 1:60807384-60807406 GCCTCCCAAGTGCCCCATGTTGG + Intergenic
911094314 1:94043268-94043290 GGCTCCCCAGTGCACCCAGGAGG - Intronic
911371894 1:97003827-97003849 GCCTCCCCAGTGCCAGCATTAGG + Intergenic
913341050 1:117758598-117758620 GTCTCCCCAGTGCCCGACATGGG - Intergenic
917834702 1:178932089-178932111 GCTTCCCCAGGGCCTGCTGTGGG - Intergenic
918497662 1:185157512-185157534 GGCTGCCCCTTGCCCGGTGTTGG + Intronic
919264097 1:195238394-195238416 TGTTCCCCAGTGCCCACAGTGGG + Intergenic
922558483 1:226550075-226550097 GGCGCCCCAGTGCCCTCTCCGGG + Intronic
923113989 1:230917148-230917170 GCCTGCTCAGTGCCTGCTGTGGG - Intronic
924653215 1:245949079-245949101 GGCTCCCAAGTGGCCAGTGTTGG - Intronic
1062858213 10:790106-790128 GCCTCGCCAGTGCCTGCTGGAGG - Intergenic
1064681681 10:17816389-17816411 GGACACCCAGTGACCGCTGTGGG + Intronic
1065585116 10:27210340-27210362 GGCACCTCAGTGCCCTCTTTGGG - Intronic
1066213145 10:33259699-33259721 GGATCACCATTGCCCGTTGTAGG - Intronic
1067052074 10:43027546-43027568 GGACCTCGAGTGCCCGCTGTAGG - Intergenic
1069588522 10:69627426-69627448 AGCTTGCCAGTGCCCACTGTTGG - Intergenic
1069913461 10:71773392-71773414 GGATCCCCAGCGCCAGCTGCCGG + Exonic
1070143842 10:73759644-73759666 GGGTCCCCATTGGCCCCTGTGGG + Exonic
1070543074 10:77431238-77431260 GCCTCTCCAGTGCCTGCTTTTGG - Intronic
1071431023 10:85607102-85607124 GGTTCCCCAGTAACCTCTGTTGG - Intronic
1075990667 10:126836206-126836228 GGCACCCCAGAGCCTGCTGGTGG - Intergenic
1076022157 10:127082784-127082806 GGCTCCCCAGGGCTAGGTGTGGG - Intronic
1076611345 10:131727724-131727746 GGCTCCCCAGAGCCACCTGAAGG + Intergenic
1076730741 10:132437661-132437683 AGCTCCCCACTTCCCTCTGTGGG + Intergenic
1076736612 10:132461933-132461955 GGCTCAGCTGTGCCCGCTGCTGG + Intergenic
1077080083 11:721228-721250 GGCTCCACAGGGCTCGTTGTGGG + Intronic
1077094267 11:792686-792708 GGCTGCCCAGGGCCAGCTCTCGG - Exonic
1077480389 11:2811891-2811913 AGCTCCCGAGTGCCCGCCGCAGG + Intronic
1077486970 11:2843425-2843447 GCCTCCCCAGGGCCCTCTGTAGG - Intronic
1077583767 11:3435073-3435095 GCCTCCCCACTACCCGCCGTGGG - Intergenic
1078102981 11:8340733-8340755 TGCTCTCCAGTGCTCTCTGTGGG - Intergenic
1078387478 11:10905183-10905205 GGCTACCCAGAGGCAGCTGTTGG + Intergenic
1078765292 11:14290611-14290633 GCCTCCCCAGTGTCCTTTGTTGG - Intronic
1079357798 11:19744336-19744358 CACTCCCCAGTGCCAGCTGTTGG + Intronic
1079934685 11:26602332-26602354 GGCTTCCCACTGCCCACAGTGGG - Intronic
1080778087 11:35404662-35404684 GGCTCCACAGTGCTCCCTGCTGG + Intronic
1083680843 11:64351267-64351289 ACCTCCCCAGGGCCCACTGTGGG - Intronic
1083792837 11:64996954-64996976 GACTTCCCAGTGCCCTCTGGAGG + Exonic
1083908528 11:65690646-65690668 AGCTCACCAGTGCCTGCTCTAGG - Intergenic
1084546825 11:69818863-69818885 CGCGCCCCAGGGCCCGCTGCGGG + Exonic
1084965335 11:72741535-72741557 GGCTGCCCCTTGCCCTCTGTGGG - Intronic
1085249697 11:75134886-75134908 GGCTCCCAGGTGTCCTCTGTGGG + Intronic
1085706558 11:78791564-78791586 GGATCTCCAGTGCCCACTGTGGG - Intronic
1095909167 12:47408454-47408476 GGCTCTGCAGTGCCCTCTCTAGG + Intergenic
1096719761 12:53512356-53512378 GTCTCCCCAGTGCCCAGTGGTGG - Exonic
1097055755 12:56248201-56248223 GGCTTCACAGTGACCGTTGTAGG + Exonic
1101829492 12:108246308-108246330 GGCTCCCCAGTGCAGCCTGGGGG + Intronic
1101987723 12:109460780-109460802 GGATCCTCATTGACCGCTGTGGG - Exonic
1102034820 12:109765159-109765181 GGCTGCCCAGTGCCCCACGTCGG + Intronic
1103936136 12:124477939-124477961 GGCTCCCCTGTGCCAGCTCCAGG + Intronic
1104048541 12:125181254-125181276 GGCACCACAGTGCCCACTGATGG - Intergenic
1104837498 12:131800871-131800893 GGCTCCCCAGTGGCTGCTCCGGG + Intergenic
1106482523 13:30147569-30147591 GGCTCCCCAGGGCCCTCTAGGGG - Intergenic
1113926153 13:113942872-113942894 AGCGCCCCAGTGCCCGCCGGAGG + Intergenic
1118901452 14:69989731-69989753 CTCTCCCCAGTGCCCAGTGTGGG + Intronic
1119427938 14:74547842-74547864 GGCTCCCAAGTCCCTGCTCTGGG - Intronic
1121026584 14:90620684-90620706 GGCACCCCACTGCCCGCTGTGGG - Intronic
1121730225 14:96181665-96181687 GAGTCCCCAGTGCCTGCGGTTGG + Intergenic
1122145733 14:99687945-99687967 GCCTCCCCAGCGCCCCCTGCAGG + Intronic
1122275397 14:100588181-100588203 GGCTGCCCCTTGCCCGCTCTGGG - Intergenic
1122342425 14:101037180-101037202 GACTCCCCAGGCCCTGCTGTGGG - Intergenic
1122882926 14:104698084-104698106 AGCTCCCCAGCCCCGGCTGTAGG - Intronic
1123112314 14:105878773-105878795 GGCCCCCCAGCGCCCGCTCCGGG + Intergenic
1202903240 14_GL000194v1_random:54994-55016 GACTCTCCAGAGCCCGCTGGGGG - Intergenic
1124007866 15:25809162-25809184 GGCTCCCCAGTGGCCGCAGATGG + Intronic
1124410466 15:29432591-29432613 GGGTCCCCAGTGCACACTGGGGG + Intronic
1126414883 15:48407109-48407131 TGCTCCCCTGTGCCCCCTGTGGG - Intergenic
1128830294 15:70762910-70762932 GGCTCCCCAGTCCCCGGGGCCGG - Intronic
1129048587 15:72758806-72758828 AGGTCCCCAGTTCCTGCTGTGGG + Intronic
1130654069 15:85779728-85779750 GGGTCCCCAGTGCCTGCACTTGG - Intronic
1132561154 16:594720-594742 GGCTTCCCTGTGCCTACTGTTGG + Intronic
1132976032 16:2711611-2711633 GGCTGCCCAGTGGCCCCCGTGGG - Intergenic
1133413854 16:5590628-5590650 GGTTCCTCAGTGCCCGATCTGGG - Intergenic
1136098576 16:27976615-27976637 GGCTGCCCAATGTCTGCTGTTGG - Intronic
1140988182 16:80179901-80179923 GGCTCTCCAGAGCCAGCTGTGGG - Intergenic
1141322051 16:83020383-83020405 GCCTCCCCACTGCCCTCTGTGGG + Intronic
1141612818 16:85192765-85192787 GGCTTCCCTGGGCCAGCTGTTGG + Intergenic
1141805833 16:86340890-86340912 GGCTCCCCTGCGCCCCCTGGTGG - Intergenic
1142352208 16:89585677-89585699 GGCTCCCCAGTGCCTGGTCTGGG + Exonic
1142625201 17:1187359-1187381 GGCTCCCCAGCGCCATCTGGCGG + Intronic
1142865904 17:2791335-2791357 CGCTTCCCAGAGCCTGCTGTGGG - Intronic
1143001483 17:3797937-3797959 GGCTCCCCACTGCCCTCAGCAGG + Intronic
1144633485 17:16888263-16888285 CATTCCCCAGTGCCCACTGTTGG + Intergenic
1144663740 17:17088216-17088238 GCCTCCCCAGTGCGGGGTGTGGG - Intronic
1144903299 17:18618546-18618568 GCTTCCCCAGTGCCTGCTTTAGG + Intergenic
1145797683 17:27665508-27665530 GACTCCCAAATGCCCTCTGTAGG + Intergenic
1145844941 17:28030517-28030539 GCGTCCCCAGTGCCCAGTGTTGG - Intergenic
1147168822 17:38606502-38606524 GGCTCCCCGGCGCCCCCTGCTGG + Intergenic
1147311304 17:39597436-39597458 GGCCCCCTCCTGCCCGCTGTGGG - Intergenic
1147325055 17:39666126-39666148 GGCTCCGCTGTGCCCGCCCTGGG + Exonic
1147388165 17:40093800-40093822 GTATCCCCAGTGCCCGGTGCAGG + Exonic
1148484467 17:47981890-47981912 GGCTCCACAGTGACAGCTGATGG - Intergenic
1148688231 17:49512636-49512658 CTCACCCCAGTGCCCACTGTTGG + Intronic
1149459031 17:56812286-56812308 GGCTGCCCTGTGCCCTGTGTAGG + Intronic
1149994031 17:61397478-61397500 GCCTCCCCAGCGCCAGCTTTCGG + Intergenic
1151387606 17:73764660-73764682 GGCTCTCCAGCACCCACTGTGGG + Intergenic
1151460874 17:74253324-74253346 GGGTCCACAGTGCCGGGTGTGGG + Intronic
1151832885 17:76565982-76566004 TTCACCCCAGTGCCCTCTGTTGG + Exonic
1152088930 17:78236492-78236514 GGCCCCCCAGTCCCAGCTGCAGG + Intronic
1152431928 17:80253071-80253093 GGCTCACCAGTGCCACCTGCGGG + Exonic
1152764626 17:82129310-82129332 TGCTCCCTAGTGCCCCCTTTTGG - Intronic
1154177123 18:12093050-12093072 CCCTCCCCAGTGCCAGCTGCAGG - Intergenic
1156204178 18:34867864-34867886 GACACCGCAGTACCCGCTGTTGG - Intronic
1160584249 18:79903925-79903947 GGCCCACCAGTGCCCGCGGCTGG + Exonic
1160724133 19:610195-610217 GGTGCCCCTGTGCCCGCTGCAGG + Intronic
1160809689 19:1008016-1008038 GGCTCCCCACTGCCCCCAGGAGG - Intronic
1160834541 19:1118468-1118490 GGCTACCAACTGCCAGCTGTGGG + Intronic
1161282663 19:3454171-3454193 GGGACCCCGGTGCCCGCCGTGGG + Intronic
1161356664 19:3822976-3822998 GGCTCCGCAGGGTCCCCTGTTGG + Intronic
1162029995 19:7913227-7913249 AGCTCCCCAGTGCCCGAGGGCGG - Exonic
1162322595 19:9978892-9978914 GGGTCCCCAGGGCCCCCTTTGGG + Exonic
1163023799 19:14497670-14497692 GGCTGGCCAGTACCCTCTGTGGG + Intergenic
1163539007 19:17895573-17895595 TGGTCCTCTGTGCCCGCTGTTGG + Intergenic
1163761310 19:19138109-19138131 GGGTCCCCAGTCCCCTCTGTGGG + Intronic
1165019123 19:32908677-32908699 GGCTCCCTAGTGGAGGCTGTCGG - Intronic
1165406090 19:35632265-35632287 GGCTCCCCAGTGCCCTCAGGAGG + Intronic
1166668863 19:44698036-44698058 GGCTCCCCAGTGCCCTTGGGAGG - Intergenic
1166861297 19:45813040-45813062 GGCTCCCCATTGCCCACAGGGGG - Intronic
1167098828 19:47391602-47391624 GGCTCTCCAGCGCCCCCTGGAGG + Intergenic
1167590638 19:50402611-50402633 GGCTACGCAGTGCCAGCTGGAGG + Exonic
1167598532 19:50440108-50440130 GGCTCCCCACTGCCCTCAGGAGG - Intronic
1168645999 19:58059608-58059630 GGCGGCCCAGTGCCCGGTGTGGG - Intronic
925914497 2:8595297-8595319 GCTTCCTCTGTGCCCGCTGTGGG + Intergenic
926172305 2:10560167-10560189 GGCTCCCCAGGCCAAGCTGTGGG - Intergenic
926772766 2:16392946-16392968 GGCTCCCCAGTCACTGCTGAGGG - Intergenic
928099730 2:28429623-28429645 GACTCTGCAGTGCCTGCTGTTGG + Intergenic
928451365 2:31381357-31381379 GGCTCACCACAGCCTGCTGTTGG - Intronic
929919643 2:46163200-46163222 GGCTCTCCAGTGGCCTCTGTGGG - Intronic
931736546 2:65199595-65199617 GGGTCCCCAGTTCCAGGTGTTGG + Intergenic
933728476 2:85439419-85439441 GGCTCCCCAGTGCCTTATGGAGG - Intergenic
934564401 2:95330359-95330381 TGCTCCCCAGTGGCCTCTGAGGG + Intronic
937905529 2:127051072-127051094 GGCTCCCCTGTGGCCCCTGCTGG - Intronic
940000220 2:148959970-148959992 GGCTCCCCAGTCCCTAATGTGGG + Intronic
942626465 2:177906274-177906296 GGCAGTGCAGTGCCCGCTGTGGG + Intronic
944139503 2:196439708-196439730 GGCTCCCCACTCCCTACTGTTGG - Intronic
947728701 2:232416580-232416602 GGGCCCCCAGTGCCATCTGTTGG - Intergenic
948185729 2:236019885-236019907 GTCTCCCCAGTGCCCCGTGTGGG + Intronic
948878035 2:240840656-240840678 GCCTCCCCAGTGCCACCTGCTGG + Intergenic
948888678 2:240896552-240896574 GGCTGCCCAGACCCCGCTGTGGG + Intronic
949046035 2:241873093-241873115 GGTTCCACAAGGCCCGCTGTGGG + Exonic
1171182298 20:23099690-23099712 GGCTCCCTAGTGCCTGCTATAGG + Intergenic
1173464747 20:43271907-43271929 TGCTCCCCAGAGCTTGCTGTTGG - Intergenic
1173821128 20:46021545-46021567 GGCTCCCCAGTGCCACCCGAAGG - Intergenic
1174146548 20:48456205-48456227 GGCTCCCCCTTGGCCTCTGTGGG + Intergenic
1174340633 20:49892897-49892919 GGCTCCCCGTGGCCCGCTTTTGG + Intergenic
1174555160 20:51389808-51389830 GGCCACTCAGTGCCCACTGTGGG - Exonic
1175238124 20:57526715-57526737 GGTTCCCCAGCGCCCCCTGCAGG - Intergenic
1175905245 20:62376458-62376480 GGCTCCCCAGGCCCCGCAGGAGG + Intergenic
1176301488 21:5101093-5101115 AGCTGCCCAGTGCCCTCTCTGGG - Intergenic
1176622604 21:9069761-9069783 GACTCTCCAGAGCCCGCTGGGGG - Intergenic
1178584167 21:33859012-33859034 GGCACCCCAGAGCCTGCTGTTGG + Intronic
1178724093 21:35035972-35035994 GCCTCCCCAGAGGCTGCTGTGGG + Intronic
1179855543 21:44160806-44160828 AGCTGCCCAGTGCCCTCTCTGGG + Intergenic
1180174603 21:46081567-46081589 GGCTCCCCTGTCCCTGCTCTGGG - Intergenic
1182126638 22:27820873-27820895 GGATCCCCAGTGCCTGCAGAGGG + Intergenic
1183395448 22:37568591-37568613 TGCTCCCCAGTGCCTGCCGAGGG - Exonic
1183653230 22:39170991-39171013 GGCTGCCCAGCGCTCGGTGTTGG + Intergenic
1184348927 22:43930555-43930577 GGCTCCCCAGTGCACGGTTCTGG + Intronic
1185132419 22:49046714-49046736 GGCTCCCCACCGCCCTCTGGAGG - Intergenic
1185421869 22:50739261-50739283 CTCTCCCCAGTGGCCCCTGTGGG + Exonic
949716300 3:6935613-6935635 GTCTCTCCAGTGCCATCTGTTGG - Intronic
949893315 3:8749423-8749445 TGATCCCCAGTGGCCTCTGTTGG + Intronic
950129694 3:10533730-10533752 GGCTCCCCAGTGCCAGTGCTGGG + Intronic
950897415 3:16466083-16466105 GGCTCCCCAGTGCTCAATTTTGG + Intronic
954451137 3:50572282-50572304 GGGGCCCCAGTGCCCCCTGGAGG - Intronic
955892541 3:63665481-63665503 TGTTGCCCAGTGCCCGCTCTGGG - Intronic
956174055 3:66456817-66456839 GGCCCGCGAGTGCCTGCTGTGGG - Intronic
957084852 3:75669536-75669558 GGCTCCCGAAAGCCCCCTGTGGG - Intergenic
961818695 3:129564287-129564309 GGCTACTCATTGCCCTCTGTGGG - Intronic
962456158 3:135567439-135567461 GCCTCTCCAGGGCCAGCTGTGGG + Intergenic
967881749 3:194306429-194306451 GCAACCCCAGGGCCCGCTGTGGG + Intergenic
968664844 4:1815381-1815403 GGCTCCCCAGTGCCACCAGCTGG + Intronic
969488520 4:7485756-7485778 GGCTCCCCTGGGCCCACAGTGGG - Intronic
970883702 4:20962224-20962246 GGATCCCCAGTTCACGGTGTAGG - Intronic
973969188 4:56194207-56194229 GGCTTACAAATGCCCGCTGTTGG - Intronic
981511712 4:145565546-145565568 GGCTCCCCAGAGAGTGCTGTAGG + Intergenic
985530222 5:429640-429662 GGCTGCCCAGTGGCGGCTGCAGG - Intronic
985574835 5:669259-669281 GGCTCACCAGCGCCCCCTGGGGG - Intronic
985732381 5:1556530-1556552 GCCTCCCCAGGGCCAGCAGTGGG + Intergenic
987825530 5:23026161-23026183 TGATCCCCAGTGACCACTGTAGG + Intergenic
991428586 5:66518751-66518773 CGCTTCTCAGTGCCCGCTGTGGG + Intergenic
996540856 5:124629231-124629253 GGCTCCCCAGTGTCCCGTGATGG + Intergenic
998764035 5:145464885-145464907 GGTACCCCAGTCCCCCCTGTTGG - Intergenic
1000266368 5:159641710-159641732 CGTTCCCCAGTGCCAGCTGTGGG + Intergenic
1001268588 5:170293483-170293505 GGCTCCCCACTGCCCTCCCTTGG + Intronic
1002323628 5:178390556-178390578 GGCCTCCCAGTGCCATCTGTGGG + Intronic
1003690247 6:8346658-8346680 AGGTGCCCAGTGCACGCTGTTGG - Intergenic
1003955550 6:11162118-11162140 GGCACCCCAATGCCCTCTCTTGG - Intergenic
1013289270 6:108706805-108706827 GGCTGCCCACTGCCTGCTGCAGG + Intergenic
1013307483 6:108862977-108862999 GGCAGCCCATTGCCCGCTGGAGG - Intronic
1015353200 6:132247073-132247095 AGCTCCACAGTGCCCGGTGCCGG + Intergenic
1017914339 6:158819562-158819584 GACTTCCCCCTGCCCGCTGTGGG - Intergenic
1017947208 6:159105261-159105283 TGCTCCTCAGTGCCAGCTGCTGG - Intergenic
1018627355 6:165792564-165792586 GTCTCCCCAGTCTCCGCTGCAGG + Intronic
1018661668 6:166093102-166093124 GGCTCCTCTGAGCCCGCTCTCGG + Intergenic
1019079787 6:169422445-169422467 AGCTCCCGAGTGCTTGCTGTGGG - Intergenic
1019733229 7:2638621-2638643 GGCTCCCACGTGGCCGCTGCTGG + Intronic
1019779493 7:2931016-2931038 GGCTGCCCAGTGCCAGGTGCTGG - Intronic
1020135525 7:5585909-5585931 GGCTCCCCAGTGCCCCAAGAGGG - Intergenic
1022466187 7:30654602-30654624 GACTCCCCAGAGCCTGCTCTTGG + Intronic
1026582825 7:71632365-71632387 GGATTCCCATTGCCCGGTGTTGG + Intronic
1033099922 7:138460920-138460942 GGCTCCCCAGCGGCCGCGGCCGG - Intronic
1034467274 7:151237529-151237551 GGCTCCCAAGTGCCCACTACAGG + Exonic
1034667490 7:152831326-152831348 GGCTGCTCAGCGCCCGCAGTGGG - Intronic
1034914662 7:155026920-155026942 GGCTCCCCAGTTTCCTCTGGGGG - Intergenic
1035401117 7:158566460-158566482 GGCTGCCAAGTGCCCGCTATGGG - Intronic
1035520365 8:271285-271307 GGCTCCCCAGCTCCAGCTCTAGG + Intergenic
1037934948 8:22909224-22909246 GGCTCCCCAGGCCTCGCTGGCGG - Intronic
1039086832 8:33788514-33788536 GGCTCCACAGTTCCCGCAGCAGG - Intergenic
1039426831 8:37493211-37493233 GCCTCCCCAGTGGCTGCTGGCGG - Intergenic
1041205403 8:55494237-55494259 TGTTCCCTAGTGCCAGCTGTGGG - Intronic
1044692905 8:94896280-94896302 GGCTCCGCAGGGCGCGCTGGCGG - Intronic
1048365567 8:133735462-133735484 GGCTCCCAAGTGGCCCCTGCTGG - Intergenic
1048959119 8:139561420-139561442 GGCTACCCAGTGCCCTCACTGGG + Intergenic
1049217601 8:141415258-141415280 GTCTCCCCACTGCCTGCTGCAGG - Intronic
1049592960 8:143470977-143470999 GGTGCCCCAGTGCCAGCTCTGGG + Intronic
1056369681 9:85941418-85941440 GGCTCCCCAGTGCCCGCTGTCGG + Intronic
1059490145 9:114660054-114660076 GGGTCCCCAGTGCAGGGTGTAGG + Intergenic
1060522733 9:124302885-124302907 GGCCCCTCTGTGCCCGGTGTGGG - Intronic
1060812711 9:126619035-126619057 GGCTCCGCCGGGCCCGCTGGGGG + Intronic
1062075520 9:134586533-134586555 GGCTCCCAAGTGCCAGCAGAGGG + Intergenic
1203745796 Un_GL000218v1:40190-40212 GACTCTCCAGAGCCCGCTGGGGG - Intergenic
1185835573 X:3343807-3343829 GGCCCCCCAGTGCGCGCGCTTGG + Exonic
1187486517 X:19709270-19709292 CCCTCCCCTGTGCCCTCTGTAGG - Intronic
1189143212 X:38628165-38628187 CCCTCCACAATGCCCGCTGTGGG + Intronic
1198428905 X:136546413-136546435 GGCCACCCAAGGCCCGCTGTTGG + Intronic
1199724933 X:150570148-150570170 GTCTTCCCAGTGCCCACCGTTGG - Intronic
1201241118 Y:11957212-11957234 GGCCCCCCAGTGCGCGCGCTTGG - Intergenic
1202202398 Y:22367243-22367265 GCCTCCCCTGGCCCCGCTGTGGG - Intronic