ID: 1056370180

View in Genome Browser
Species Human (GRCh38)
Location 9:85946212-85946234
Sequence CTATAGTCAAGGCTGTAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 740
Summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 696}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056370180 Original CRISPR CTATAGTCAAGGCTGTAGTG AGG (reversed) Intronic
900388908 1:2425124-2425146 CTATCGCCTAGGCTGGAGTGCGG - Intergenic
901392052 1:8952691-8952713 CTGTAGCCCAGGCTGGAGTGCGG + Intronic
901418736 1:9135892-9135914 CTATTGCCTAGGCTGGAGTGTGG + Intergenic
901708829 1:11097687-11097709 CTATTGCCCAGGCTGGAGTGCGG - Intronic
901746998 1:11380472-11380494 CTGTAGCCCAGGCTGGAGTGCGG - Intergenic
901863074 1:12087202-12087224 CTGTAGTCCAGGCTGGAGTACGG + Intronic
902425406 1:16317376-16317398 CTATTGCCCAGGCTGGAGTGCGG - Intronic
902521084 1:17016968-17016990 CTGTCGTCCAGGCTGGAGTGTGG - Intergenic
902778728 1:18691014-18691036 CTGTTGTCCAGGCTGAAGTGTGG + Intronic
904171801 1:28596583-28596605 CTATCGCCCAGGCTGGAGTGCGG - Intronic
904292932 1:29499279-29499301 CTATTGTCAGGGCTGTCATGAGG + Intergenic
904393830 1:30204769-30204791 CTATTGTCAAGTTTGTATTGGGG - Intergenic
904499156 1:30904186-30904208 CTATCGCCAAGGCTGGAGTGTGG - Intronic
904520356 1:31090329-31090351 CTGTAGCCCAGGCTGGAGTGCGG - Intergenic
904538027 1:31213955-31213977 CTGTGGTCCAGGCTGGAGTGTGG - Intronic
904635799 1:31880048-31880070 CTGTAGCCCAGGCTGGAGTGCGG - Intergenic
904690480 1:32290135-32290157 CTATTGCCCAGGCTGGAGTGTGG + Intergenic
905424488 1:37872025-37872047 CTGTTGTCCAGGCTGGAGTGCGG - Intronic
905553409 1:38861339-38861361 CTGTCGCCAAGGCTGGAGTGCGG - Intronic
905754471 1:40497375-40497397 CTATTGTCCAGGCTGGAGTGTGG + Intergenic
906049384 1:42857900-42857922 CTATTGTCAAGTTTGTACTGGGG - Intergenic
906099060 1:43244864-43244886 CTGTTGTCCAGGCTGGAGTGCGG - Intronic
906135590 1:43498464-43498486 CTATTGCCCAGGCTGGAGTGCGG + Intergenic
906303290 1:44699484-44699506 CTATCGCCCAGGCTGGAGTGTGG + Intronic
906340019 1:44971331-44971353 CTGTAGCCCAGGCTGGAGTGCGG - Intronic
906429659 1:45745022-45745044 CTGTTGTCTAGGCTGGAGTGTGG - Intronic
906784661 1:48604094-48604116 CCGTAGCCCAGGCTGTAGTGCGG - Intronic
906973696 1:50546400-50546422 CTGTCGTCTAGGCTGGAGTGCGG + Intronic
907139073 1:52168552-52168574 CTGTAGCCCAGGCTGGAGTGCGG + Intronic
907323354 1:53619418-53619440 CCATGGTAAGGGCTGTAGTGGGG - Intronic
907416277 1:54316304-54316326 CTGTCGTCCAGGCTGGAGTGCGG - Intronic
907613653 1:55900862-55900884 CTGTTGTCCAGGCTGGAGTGTGG + Intergenic
908154759 1:61341513-61341535 CTGTTGTCCAGGCTGGAGTGTGG + Intronic
908194067 1:61731649-61731671 CTATCATCCAGGCTGGAGTGTGG + Intergenic
908341657 1:63186698-63186720 CTATTGCCCAGGCTGGAGTGCGG - Intergenic
908451996 1:64264911-64264933 CCATTGTCCAGGCTGGAGTGCGG - Intronic
908730295 1:67219329-67219351 CTATTGCCCAGGCTGGAGTGCGG - Intronic
909260378 1:73481226-73481248 ATATAGTCAAGCCTGAAGTATGG + Intergenic
909484193 1:76155502-76155524 CTGTCGTCCAGGCTGGAGTGCGG + Intronic
909640483 1:77866718-77866740 CTGTTGTCCAGGCTGGAGTGTGG + Intronic
909817853 1:80018818-80018840 CTTATGACAAGGCTGTAGTGTGG - Intergenic
910711712 1:90188775-90188797 CTATGGTCCAGGCTGGAGTGTGG + Intergenic
911343068 1:96662797-96662819 CTGTCGTCCAGGCTGGAGTGCGG + Intergenic
911518548 1:98899693-98899715 CTGTCGCCCAGGCTGTAGTGCGG + Intronic
911611462 1:99962764-99962786 CTATTGCCCAGGCTGGAGTGTGG - Intergenic
913185797 1:116369758-116369780 CTTTTGTCCAGGCTGAAGTGCGG - Intergenic
913233571 1:116761865-116761887 CTGTTGCCAAGGCTGGAGTGTGG + Intronic
915102788 1:153512891-153512913 CTATAATCAAAGCTGCAGTTAGG + Intergenic
915132451 1:153704996-153705018 CTGTAGCCCAGGCTGGAGTGTGG - Intergenic
915512832 1:156395943-156395965 CTGTCGTCCAGGCTGGAGTGCGG - Intergenic
916066516 1:161140403-161140425 CTATCACCCAGGCTGTAGTGCGG - Intergenic
916642252 1:166742930-166742952 CTATTGCCCAGGCTGGAGTGCGG - Intergenic
916908747 1:169320431-169320453 CTATAGTAAAGCCTGTAGTGAGG - Intronic
917567318 1:176226201-176226223 CTGTAGCCCAGGCTGGAGTGCGG + Intergenic
917865279 1:179188508-179188530 CTGTTGTCCAGGCTGGAGTGTGG - Intronic
917921573 1:179755098-179755120 CTGTAGTCCAGGCTAGAGTGCGG - Intronic
919680598 1:200431043-200431065 CTATTGCCCAGGCTGGAGTGCGG + Intergenic
920975116 1:210778492-210778514 CTGTAGCCCAGGCTGGAGTGCGG - Intronic
921710234 1:218366341-218366363 CTGTTGTCCAGGCTGGAGTGTGG + Intronic
922521671 1:226258134-226258156 CTGTAGCCTAGGCTGGAGTGCGG - Intronic
922611590 1:226933490-226933512 CTGTAGCCCAGGCTGGAGTGCGG + Intronic
923260373 1:232262189-232262211 CTATCACCAAGGCTGGAGTGCGG + Intergenic
923356744 1:233163702-233163724 AGAAAGTCAAGGCTATAGTGAGG - Intronic
923738885 1:236637493-236637515 ATAGAGTCAAGGATATAGTGAGG - Intergenic
924371478 1:243355640-243355662 CTGTTGTCCAGGCTGGAGTGCGG + Intronic
924588416 1:245380349-245380371 CTATATTCAAGGCTGTGGCTGGG + Intronic
1063416982 10:5881722-5881744 CTGTCGTCCAGGCTGGAGTGCGG + Intronic
1063682757 10:8205565-8205587 CTGTCGCCCAGGCTGTAGTGCGG - Intergenic
1063996209 10:11622404-11622426 CTGTTGCCCAGGCTGTAGTGTGG - Intergenic
1064404129 10:15045992-15046014 CTATCGCCCAGGCTGGAGTGTGG - Intronic
1064708112 10:18093971-18093993 CTGTAGCCCAGGCTGGAGTGCGG + Intergenic
1064876815 10:20003863-20003885 CTACTGCCAAGGCTGTGGTGTGG + Intronic
1064976896 10:21126273-21126295 CTATACTTAAGGCTGTAATGAGG - Intronic
1065849484 10:29775410-29775432 CTGTAGCCCAGGCTGGAGTGCGG + Intergenic
1066093858 10:32054606-32054628 CTATAGTTAATACTGTATTGGGG - Intronic
1067343704 10:45423222-45423244 CCAGAGTCAAGGCTGAAGAGTGG + Intronic
1067351125 10:45475903-45475925 GTATGGTGGAGGCTGTAGTGAGG - Intronic
1067400544 10:45969750-45969772 GGATAGTCAAGGCTGTAGACAGG - Intergenic
1067423226 10:46177890-46177912 CTATTGCCCAGGCTGGAGTGTGG + Intergenic
1067868888 10:49939307-49939329 GGATAGTCAAGGCTGTAGACAGG - Intronic
1069477344 10:68746311-68746333 CTATCGCCCAGGCTGGAGTGCGG + Intronic
1069534571 10:69243531-69243553 CTCTAGCCCAGGCTGAAGTGCGG + Intronic
1069762855 10:70826146-70826168 CTGTCGTCCAGGCTGGAGTGCGG - Intronic
1070254909 10:74805696-74805718 CTATTGCCCAGGCTGGAGTGCGG + Intergenic
1070539952 10:77408853-77408875 CTTTACACAAGGCTCTAGTGGGG - Intronic
1071142175 10:82522078-82522100 CTTTAGCCCAGGCTGGAGTGCGG + Intronic
1072230101 10:93407389-93407411 CTGTTGCCAAGGCTGGAGTGTGG - Intronic
1072821260 10:98560040-98560062 ATACAGTAAAGTCTGTAGTGAGG - Intronic
1072823367 10:98580975-98580997 CTGTAGCCCAGGCTGGAGTGTGG + Intronic
1072952302 10:99858475-99858497 CTCAACTGAAGGCTGTAGTGAGG + Intergenic
1073379063 10:103064041-103064063 CTATAGAGAGGGATGTAGTGGGG + Intronic
1073462572 10:103674781-103674803 CTGTTGTCCAGGCTGGAGTGCGG - Intronic
1075081644 10:119387985-119388007 CTATTGCCCAGGCTGGAGTGCGG + Intronic
1075485230 10:122816645-122816667 CTGTTGCCAAGGCTGGAGTGCGG + Intergenic
1075750778 10:124769179-124769201 CTGTAGCCCAGGCTGGAGTGCGG - Intronic
1075774568 10:124973187-124973209 CTATCGCCTAGGCTGGAGTGCGG + Intronic
1076877312 10:133222244-133222266 CTATCGCCCAGGCTGGAGTGCGG - Intronic
1077662294 11:4080501-4080523 CTATTGCCCAGGCTGGAGTGTGG + Intronic
1078227354 11:9404600-9404622 CTGTTGCCCAGGCTGTAGTGCGG + Intronic
1078400118 11:11018996-11019018 CTATTGCCCAGGCTGGAGTGCGG + Intergenic
1079083709 11:17430813-17430835 CTACCGTCAAAGCTCTAGTGAGG - Exonic
1079226498 11:18610627-18610649 CTGTCGCCAAGGCTGGAGTGCGG - Intronic
1080119109 11:28655963-28655985 CTTTATTCAAGGTTGCAGTGAGG + Intergenic
1080440687 11:32291591-32291613 CTATTGCCCAGGCTGGAGTGCGG - Intergenic
1081466183 11:43320080-43320102 CTATTGGCCAGGCTGGAGTGCGG + Intronic
1081741527 11:45444446-45444468 CTGTTGTCCAGGCTGGAGTGCGG - Intergenic
1082021056 11:47533584-47533606 CTGTAGCCCAGGCTGGAGTGCGG - Intronic
1082161281 11:48891274-48891296 CTGTAGCCTAGGCTGGAGTGCGG + Intergenic
1082166693 11:48957714-48957736 CTGTAGCCTAGGCTGGAGTGCGG - Intergenic
1082236909 11:49828993-49829015 CTGTAGCCTAGGCTGGAGTGTGG + Intergenic
1083456272 11:62780898-62780920 CTATTGCCCAGGCTGGAGTGCGG - Intronic
1083598626 11:63932470-63932492 CTATTGCCCAGGCTGGAGTGCGG + Intergenic
1083991025 11:66245843-66245865 CTGTCGTCCAGGCTGGAGTGCGG - Intergenic
1084361644 11:68672517-68672539 CTCTTGTCCAGGCTGGAGTGTGG + Intergenic
1084987905 11:72893350-72893372 CTATTGCCCAGGCTGGAGTGCGG + Intronic
1085292973 11:75413275-75413297 CTGTAGCCCAGGCTGGAGTGCGG + Intronic
1085537143 11:77228649-77228671 CTATTGCCCAGGCTGGAGTGCGG - Intronic
1088105873 11:106206140-106206162 ATAAAGTCAAGTCTGCAGTGAGG - Intergenic
1088273333 11:108058170-108058192 CTATCGCCCAGGCTGGAGTGTGG - Intronic
1088441114 11:109871294-109871316 CTGTCGCCAAGGCTGGAGTGCGG - Intergenic
1088629457 11:111760610-111760632 CTGTTGTCTAGGCTGGAGTGCGG - Intronic
1088659944 11:112035523-112035545 CTGTTGTCCAGGCTGGAGTGCGG + Intronic
1088811644 11:113396374-113396396 CTCTGGTCCAGGCTGGAGTGTGG + Intronic
1088817956 11:113434281-113434303 CTATTGCCAAGGCTGTGCTGGGG - Intronic
1089501192 11:118932329-118932351 CTATCGTCCAGGCTGGAGTGCGG + Intronic
1091492204 12:942709-942731 CTGTCGTCCAGGCTGGAGTGCGG - Intronic
1091505471 12:1063295-1063317 CTGTCGCCCAGGCTGTAGTGTGG + Intronic
1092221184 12:6715028-6715050 CTATCGTCTAGGCTGAAGTGTGG - Intergenic
1092342540 12:7688912-7688934 CTGTCGTCCAGGCTGGAGTGCGG - Intergenic
1092449336 12:8587248-8587270 CTATCGCCCAGGCTGGAGTGCGG + Intergenic
1092898667 12:13038025-13038047 CTATTGCCCAGGCTGGAGTGTGG - Intergenic
1093639880 12:21513757-21513779 CTATTGCCCAGGCTATAGTGTGG - Intronic
1093898391 12:24602539-24602561 CTGTAGCCCAGGCTGGAGTGCGG + Intergenic
1093997180 12:25655025-25655047 CTATTGCCCAGGCTGGAGTGCGG + Intergenic
1094572574 12:31654084-31654106 CTGTCGTCCAGGCTGGAGTGTGG + Intronic
1094615185 12:32029936-32029958 CTGTAGCCCAGGCTGCAGTGTGG - Intergenic
1095051798 12:37561118-37561140 CTATTGCCCAGGCTGGAGTGCGG - Intergenic
1095052239 12:37564772-37564794 CTATAGTCCAGGCTGGAGCATGG - Intergenic
1095187236 12:39214942-39214964 CAATAGTCAAGACTGGAATGAGG + Intergenic
1095659357 12:44711617-44711639 TTATAGACATGGCTGCAGTGTGG - Intronic
1095721874 12:45409790-45409812 CTGTAGCCCAGGCTGGAGTGTGG + Intronic
1095884457 12:47174370-47174392 CTATAGCCTAGGCTGGAGTGCGG - Intronic
1095957596 12:47815646-47815668 CTATTGCCCAGGCTGGAGTGAGG + Intronic
1096162880 12:49395034-49395056 CTATTGCCCAGGCTGGAGTGCGG - Intronic
1096342347 12:50811752-50811774 CTATTGCCCAGGCTGGAGTGCGG - Intronic
1096857540 12:54495563-54495585 CTATCGACCAGGCTGGAGTGCGG + Intergenic
1097047240 12:56196265-56196287 CTGTTGCCAAGGCTGGAGTGTGG + Intergenic
1097953200 12:65455771-65455793 CTGTTGCCAAGGCTGGAGTGTGG + Intronic
1098545307 12:71705326-71705348 CTATTGCCCAGGCTGGAGTGCGG + Intergenic
1099854220 12:88142859-88142881 ATAAAGTCAAGGCTCTAGAGAGG + Intronic
1100009886 12:89940486-89940508 CTGTTGTCCAGGCTGGAGTGCGG + Intergenic
1100498207 12:95145712-95145734 CTGTCGTCCAGGCTGGAGTGTGG + Intronic
1101005138 12:100394436-100394458 CTGTAGCCCAGGCTGAAGTGCGG + Intronic
1101932267 12:109024292-109024314 CTATCATCCAGGCTGGAGTGTGG + Intronic
1102332407 12:112045448-112045470 CTGTCGTCCAGGCTGGAGTGCGG - Intronic
1102357044 12:112246093-112246115 CTGTTGTCCAGGCTGGAGTGCGG - Intronic
1102534280 12:113569343-113569365 CTATCGCCCAGGCTGGAGTGCGG + Intergenic
1102641660 12:114372339-114372361 CTGTTGTCCAGGCTGGAGTGAGG + Intronic
1102870088 12:116407302-116407324 CTATTGCCCAGGCTGGAGTGTGG - Intergenic
1103072047 12:117952637-117952659 CTATTGCCTAGGTTGTAGTGTGG - Intronic
1103093352 12:118113403-118113425 CTATTGCCTAGGCTGGAGTGTGG - Intronic
1103245590 12:119454363-119454385 CTATAGTGATGGCTTGAGTGAGG - Intronic
1103690749 12:122772753-122772775 CTATTGCCTAGGCTGGAGTGAGG + Intergenic
1104839415 12:131814816-131814838 CTATTGCCCAGGCTGGAGTGTGG + Intergenic
1105205626 13:18221184-18221206 CAATAGTCAAGGAGGCAGTGGGG + Intergenic
1105394116 13:20012210-20012232 CTGTAGCCCAGGCTGGAGTGCGG + Intronic
1105596612 13:21845185-21845207 CTGTAGTCCAGGCTGGAGTGCGG + Intergenic
1106855741 13:33849838-33849860 CTGTAGTCCAGGCTGGAGTGTGG - Intronic
1106886254 13:34187662-34187684 CTGTTGTCCAGGCTGGAGTGTGG + Intergenic
1107216180 13:37921738-37921760 CTATTGCCCAGGCTGGAGTGCGG + Intergenic
1107854595 13:44602668-44602690 CTATTGCCCAGGCTGGAGTGCGG + Intergenic
1107910926 13:45105155-45105177 CTGTAGCCCAGGCTGGAGTGCGG - Intergenic
1108097123 13:46914483-46914505 CTGTTGCCCAGGCTGTAGTGTGG + Intergenic
1108400319 13:50035246-50035268 CTGTTGCCAAGGCTGGAGTGCGG + Intergenic
1108969484 13:56354939-56354961 CTATCGCCCAGGCTGGAGTGCGG - Intergenic
1109119676 13:58438728-58438750 CTATTGCCCAGGCTGGAGTGTGG - Intergenic
1109497583 13:63193723-63193745 CTACAGTCAAGGATGAGGTGAGG + Intergenic
1110894784 13:80736049-80736071 CTGTTGTCCAGGCTGGAGTGTGG + Intergenic
1111293034 13:86192960-86192982 CTTTAGTGAAGGCTAGAGTGGGG - Intergenic
1112118813 13:96386963-96386985 CTGTTGTCCAGGCTGGAGTGCGG + Intronic
1112239047 13:97663212-97663234 CTGTTGCCCAGGCTGTAGTGCGG + Intergenic
1112761654 13:102699044-102699066 CTATAGTCAGGGCTGGGTTGTGG + Intergenic
1113154216 13:107299397-107299419 CTGTAGCCCAGGCTGGAGTGCGG - Intronic
1113532061 13:111034484-111034506 CTGTTGTCCAGGCTGGAGTGCGG - Intergenic
1114164926 14:20211418-20211440 CTGTCGTCCAGGCTGGAGTGCGG - Intergenic
1114280663 14:21190135-21190157 CTGTAGCCCAGGCTGGAGTGCGG - Intergenic
1114443764 14:22772059-22772081 CTATTGCCCAGGCTGGAGTGCGG - Exonic
1114464995 14:22915530-22915552 CTGTTGTCCAGGCTGGAGTGCGG + Intronic
1114716168 14:24827162-24827184 CTATTGTCCAGACTGGAGTGCGG - Intronic
1115198348 14:30826177-30826199 CTATCCTCCAGGCTGGAGTGCGG - Intergenic
1115264798 14:31490303-31490325 CTATCATCCAGGCTGGAGTGTGG + Intronic
1115471270 14:33770861-33770883 CTGTAGTCCAGGCTGGAGTGCGG - Intronic
1115991477 14:39154962-39154984 CTGTTGTCTAGGCTGGAGTGTGG + Intronic
1116748192 14:48848265-48848287 CTGTTGCCAAGGCTGGAGTGTGG + Intergenic
1116819284 14:49611885-49611907 CTGCAGCCCAGGCTGTAGTGTGG - Intronic
1116961057 14:50968933-50968955 CTGTCGTCTAGGCTGGAGTGCGG + Intergenic
1117409948 14:55441181-55441203 CTGTCGCCAAGGCTGGAGTGCGG + Intronic
1118664845 14:68056709-68056731 CTGTCGCCAAGGCTGGAGTGTGG - Intronic
1119812506 14:77534119-77534141 CTGTTGTCCAGGCTGTAGTGCGG - Intronic
1119839727 14:77783051-77783073 CTATCGCCCAGGCTGGAGTGTGG - Intergenic
1119922241 14:78457073-78457095 CTGTGGTCCAGGCTGGAGTGCGG + Intronic
1120394476 14:83952254-83952276 TGATAGTAGAGGCTGTAGTGAGG + Intergenic
1120461018 14:84795472-84795494 CTGTCATCCAGGCTGTAGTGTGG + Intergenic
1120891804 14:89498251-89498273 CTATAGCCCAGGCTGGAGTACGG + Intronic
1121015927 14:90549089-90549111 CTGTTGCCCAGGCTGTAGTGCGG - Intronic
1121422744 14:93826805-93826827 CTGTAGCCCAGGCTGGAGTGCGG - Intergenic
1121623595 14:95368575-95368597 CTGTAGCCCAGGCTGGAGTGCGG - Intergenic
1124034247 15:26039383-26039405 CTGTAGTCCAGGCTGGAGTGCGG + Intergenic
1124697225 15:31874567-31874589 CTATTGCCTAGGCTGGAGTGCGG + Intergenic
1125461769 15:39914007-39914029 CTGTTGTCCAGGCTGGAGTGCGG - Intronic
1125843725 15:42830966-42830988 CTGTTGCCCAGGCTGTAGTGCGG - Intronic
1125912036 15:43449088-43449110 CTGTCATCCAGGCTGTAGTGCGG - Intronic
1125954913 15:43783796-43783818 CTGTCGTCCAGGCTGGAGTGTGG + Intronic
1125980771 15:43999102-43999124 CTATTGCCCAGGCTGGAGTGTGG + Intronic
1127062965 15:55206172-55206194 CTATTGCCCAGGCTGGAGTGCGG - Intronic
1127129487 15:55847711-55847733 CTGTTGTCCAGGCTGGAGTGTGG + Intronic
1127243434 15:57144633-57144655 CTGTAATCCAGGCTGGAGTGTGG + Intronic
1127430948 15:58907582-58907604 CTGTCGTCCAGGCTGGAGTGTGG - Intronic
1127446575 15:59069035-59069057 CTGTCGCCAAGGCTGGAGTGTGG - Intronic
1127870087 15:63064928-63064950 CTGTCGTCCAGGCTGGAGTGCGG - Intronic
1128545496 15:68564338-68564360 CTATTGCCCAGGCTGCAGTGGGG + Intergenic
1128882706 15:71258213-71258235 CTATTGCCCAGGCTGGAGTGCGG + Intronic
1129114216 15:73356221-73356243 CTGTAGCCCAGGCTGGAGTGTGG + Intronic
1129283731 15:74506658-74506680 CTGTTGCCCAGGCTGTAGTGTGG - Intergenic
1129382231 15:75175307-75175329 CTATTGCCCAGGCTGGAGTGCGG + Intergenic
1129430670 15:75499440-75499462 CTATCGCCCAGGCTGGAGTGCGG + Intronic
1130631498 15:85573506-85573528 CTGTCGCCAAGGCTGGAGTGCGG - Intronic
1130668217 15:85887408-85887430 CTATTGCCCAGGCTGGAGTGTGG - Intergenic
1130958291 15:88642651-88642673 CTATCGCCCAGGCTGGAGTGTGG + Intronic
1131082063 15:89545139-89545161 CTCTCGTCCAGGCTGGAGTGTGG + Intergenic
1131085599 15:89573259-89573281 CTGTCGTCCAGGCTGGAGTGCGG - Intergenic
1131467937 15:92670366-92670388 CTGTTGTCCAGGCTGGAGTGCGG - Intronic
1131656188 15:94461421-94461443 CTGTTGCCCAGGCTGTAGTGTGG - Intronic
1132057740 15:98664992-98665014 CTGTCGTCCAGGCTGGAGTGTGG + Intronic
1132074727 15:98810583-98810605 CTGTAGCCCAGGCTGGAGTGCGG + Intronic
1132323988 15:100951064-100951086 CTGTAGCCCAGGCTGGAGTGCGG - Intronic
1132396083 15:101475520-101475542 CTGTCGTCCAGGCTGGAGTGCGG + Intronic
1132511514 16:344391-344413 CTATCGCCCAGGCTGGAGTGCGG - Intronic
1132644590 16:993004-993026 CTATCGCCCAGGCTGGAGTGCGG - Intergenic
1133007334 16:2891439-2891461 CTATCGCCCAGGCTGGAGTGCGG + Intronic
1133032683 16:3018927-3018949 CTCTCGCCAAGGCTGGAGTGTGG + Intronic
1133566169 16:6995722-6995744 CTATGGCCCAGGCTGCAGTGCGG - Intronic
1133813609 16:9179797-9179819 CTGTTGCCCAGGCTGTAGTGCGG + Intergenic
1133869737 16:9675820-9675842 CTATTGTCAAGTTTGTATTGGGG + Intronic
1134229572 16:12418549-12418571 CTGTTGTCCAGGCTGGAGTGCGG + Intronic
1134286482 16:12866500-12866522 CTGTTGCCCAGGCTGTAGTGCGG + Intergenic
1135108450 16:19671430-19671452 CTGTTGTCCAGGCTGGAGTGCGG - Intronic
1135317444 16:21461772-21461794 CTGTAGCCCAGGCTGGAGTGCGG + Intergenic
1135370342 16:21893581-21893603 CTGTAGCCCAGGCTGGAGTGCGG + Intergenic
1135441447 16:22477118-22477140 CTGTAGCCCAGGCTGGAGTGCGG - Intergenic
1135642326 16:24131494-24131516 CTATAGTCAACTCTGTTGTACGG - Intronic
1135657817 16:24267001-24267023 CTATCGCCCAGGCTGGAGTGCGG + Intronic
1135671151 16:24376682-24376704 CTTTCGTCCAGGCTGGAGTGCGG + Intergenic
1135736323 16:24934488-24934510 CTGTTGTCCAGGCTGGAGTGCGG + Intronic
1135771600 16:25222100-25222122 CTGTTGTCCAGGCTGGAGTGTGG + Intronic
1135888983 16:26340115-26340137 CTGTAGCCCAGGCTGGAGTGCGG - Intergenic
1136095070 16:27949581-27949603 CTATCGTCCAGGCTGGAGTGCGG - Intronic
1136314233 16:29441514-29441536 CTGTAGCCCAGGCTGGAGTGCGG + Intergenic
1136327672 16:29543279-29543301 CTGTAGCCCAGGCTGGAGTGCGG + Intergenic
1136372179 16:29843456-29843478 CTGTTGTCCAGGCTGGAGTGTGG - Intronic
1137975203 16:53025332-53025354 CTATCATCCAGGCTGTAGTGCGG - Intergenic
1138046555 16:53731602-53731624 CTGTAGCCCAGGCTGGAGTGCGG + Intronic
1139586477 16:67907295-67907317 CTTTTGTCCAGGCTGGAGTGGGG + Intronic
1139695513 16:68671556-68671578 CTGTTGTCCAGGCTGGAGTGAGG + Intronic
1139889165 16:70237001-70237023 CTGTAGCCCAGGCTGGAGTGCGG + Intergenic
1139913643 16:70414707-70414729 CTGTCATCCAGGCTGTAGTGCGG + Intronic
1140862982 16:79035573-79035595 CTATCATCCAGGCTGGAGTGTGG + Intronic
1141190278 16:81819619-81819641 CTTTCGCCCAGGCTGTAGTGCGG + Intronic
1141547882 16:84784405-84784427 CTGTAGCCCAGGCTGGAGTGCGG + Intergenic
1141585771 16:85032665-85032687 CTGTCGTCCAGGCTGGAGTGCGG + Intronic
1143053612 17:4146130-4146152 CTTTAGCCCAGGCTGGAGTGCGG + Intronic
1143442733 17:6988151-6988173 CTATAGTCAATGCTATGGTTTGG + Intronic
1143639077 17:8185173-8185195 CTGTCGTCCAGGCTGGAGTGCGG - Intergenic
1144869638 17:18361260-18361282 CTGTTGTCCAGGCTGGAGTGCGG - Intronic
1147525640 17:41219596-41219618 CTGTCGCCCAGGCTGTAGTGCGG - Intronic
1147676108 17:42206911-42206933 CTATTGCCCAGGCTGGAGTGTGG + Intronic
1148020576 17:44550569-44550591 CTGTTGTCCAGGCTGGAGTGCGG + Intergenic
1148174576 17:45552459-45552481 CTGTTGTCCAGGCTGGAGTGCGG - Intergenic
1148296794 17:46510567-46510589 CTGTTGTCCAGGCTGGAGTGCGG + Intergenic
1148401211 17:47363106-47363128 CTGTTGCCCAGGCTGTAGTGCGG + Intronic
1148979345 17:51558536-51558558 CAATGTACAAGGCTGTAGTGGGG - Intergenic
1149440186 17:56667390-56667412 CTATCATCCAGGCTGGAGTGCGG + Intergenic
1149474185 17:56945299-56945321 CTATCGCCCAGGCTGGAGTGTGG - Intronic
1150164291 17:62926806-62926828 CTATTGCCAAGCCTGGAGTGCGG + Intergenic
1150320326 17:64208273-64208295 CTATTGCCCAGGCTGGAGTGCGG + Intronic
1150702777 17:67462266-67462288 CTGTCGTCCAGGCTGGAGTGCGG + Intronic
1150729457 17:67679214-67679236 CTATCGCCCAGGCTGGAGTGTGG - Intronic
1150763677 17:67986505-67986527 CTATCGGCCAGGCTGGAGTGCGG - Intergenic
1150786947 17:68170666-68170688 CTATTGCCCAGGCTGGAGTGCGG + Intergenic
1150961557 17:69918519-69918541 CTGTTGCCAAGGCTGGAGTGTGG + Intergenic
1151771470 17:76165322-76165344 CTATCGCCCAGGCTGGAGTGCGG + Intronic
1152268301 17:79309068-79309090 CTGTTGTCCAGGCTGGAGTGCGG - Intronic
1152931903 17:83114222-83114244 CTGTCGTCCAGGCTGGAGTGCGG + Intergenic
1152934832 17:83130267-83130289 CTGTAGCCCAGGCTGGAGTGCGG + Intergenic
1152957705 18:53504-53526 CTATTGCCCAGGCTGGAGTGTGG + Intronic
1153693391 18:7616191-7616213 CTGTTGCCAAGGCTGGAGTGTGG + Intronic
1154211816 18:12385697-12385719 CTGTAGTCCAGGCTGGAGTGCGG - Intergenic
1154276350 18:12964670-12964692 CTATTGCCCAGGCTGGAGTGTGG + Intronic
1154985719 18:21548899-21548921 CTATTGGCCAGGCTGAAGTGCGG - Intronic
1155204855 18:23549600-23549622 CTGTTGTCCAGGCTGGAGTGCGG - Intronic
1155270025 18:24131674-24131696 CTGTTGTCCAGGCTGGAGTGTGG - Intronic
1156102739 18:33617452-33617474 CTGTTGTCCAGGCTGGAGTGCGG - Intronic
1156322910 18:36044649-36044671 CTGTCGTCCAGGCTGGAGTGCGG - Intronic
1156764035 18:40629586-40629608 CTGTAGTCCAGGCTGGAGTGCGG - Intergenic
1158278357 18:55793384-55793406 CTATAGCCCAGGCTTGAGTGTGG + Intergenic
1158355681 18:56616093-56616115 CTATTGCCCAGGCTGGAGTGCGG - Intronic
1158719502 18:59911485-59911507 CTATGGTCCAGGCTACAGTGTGG - Intergenic
1158965920 18:62622097-62622119 CTGTTGCCCAGGCTGTAGTGCGG - Intergenic
1158967574 18:62636142-62636164 CCATAGTCCAGGCTGCTGTGAGG + Intergenic
1158976224 18:62714159-62714181 CTGTCGTCCAGGCTGGAGTGCGG - Intergenic
1159615231 18:70572103-70572125 CTGTTGTCCAGGCTGAAGTGCGG - Intergenic
1159800145 18:72888824-72888846 CTATCGCCCAGGCTGGAGTGCGG - Intergenic
1159819929 18:73128614-73128636 CTGTTGTCCAGGCTGGAGTGCGG - Intergenic
1160136044 18:76272682-76272704 CTGTCGTCCAGGCTGGAGTGCGG - Intergenic
1160489048 18:79321417-79321439 CTATTGCCCAGGCTGGAGTGCGG + Intronic
1160775135 19:852027-852049 CTATCGCCCAGGCTGGAGTGCGG - Intronic
1161365448 19:3876653-3876675 CTGTAGCCCAGGCTGGAGTGCGG - Intergenic
1161367591 19:3889555-3889577 CTGTTGTCCAGGCTGGAGTGCGG - Intronic
1161427869 19:4214201-4214223 CTGTTGTCCAGGCTGGAGTGCGG + Intronic
1161524761 19:4746992-4747014 CTGTCGTCCAGGCTGGAGTGCGG - Intergenic
1161662751 19:5557306-5557328 CTGTTGTCCAGGCTGGAGTGCGG - Intergenic
1161824603 19:6553992-6554014 CTGTCGTCCAGGCTGGAGTGCGG + Intergenic
1161905346 19:7152342-7152364 CTATCGTCCAGGCTGGAGTGCGG - Intronic
1162177729 19:8843891-8843913 ATGTAGTCCAGGCTGGAGTGCGG + Intergenic
1162244826 19:9391111-9391133 CAGAAGTCAAGGCTGCAGTGAGG + Intergenic
1162437767 19:10672691-10672713 CTGTAGCCCAGGCTGGAGTGTGG + Intronic
1162544939 19:11323552-11323574 CTATTGCCCAGGCTGGAGTGCGG - Exonic
1162766929 19:12925250-12925272 CTGTTGTCCAGGCTGGAGTGCGG + Intronic
1162893339 19:13749667-13749689 CTATCGCCCAGGCTGGAGTGTGG + Intronic
1162946193 19:14045248-14045270 CTATTGTACAGGCTGAAGTGCGG - Intronic
1163331703 19:16642787-16642809 CTGTTGCCAAGGCTGGAGTGTGG - Intronic
1163761817 19:19141220-19141242 CTATTGCCCAGGCTGTACTGCGG - Intergenic
1163771935 19:19196523-19196545 CTGTTGTCCAGGCTGGAGTGCGG - Intronic
1164857129 19:31533776-31533798 CTATGGCCCAGGCTGGAGTGCGG + Intergenic
1164865702 19:31602588-31602610 CTGTTGTCCAGGCTGGAGTGCGG - Intergenic
1164866247 19:31606745-31606767 CTATCGCCCAGGCTGGAGTGAGG + Intergenic
1165571736 19:36781010-36781032 CTATCGTCCAGGCTGGAGTGTGG + Intergenic
1166130193 19:40741404-40741426 CTGTCGTCCAGGCTGGAGTGCGG - Exonic
1166655607 19:44609280-44609302 CTGTAGCCCAGGCTGGAGTGCGG - Intergenic
1166726414 19:45030758-45030780 CTATTGCCCAGGCTGCAGTGCGG - Intronic
1167076909 19:47255894-47255916 CTGTCGTCTAGGCTGCAGTGCGG + Intergenic
1167316004 19:48763065-48763087 CTATAGCCAATGCTTGAGTGTGG - Intergenic
1167488110 19:49775189-49775211 GTATTGTCCAGGCTGGAGTGTGG - Intronic
1168013984 19:53556672-53556694 CTGTCATCAAGGCTGGAGTGCGG + Intronic
1168074232 19:53970586-53970608 CTGTTGCCCAGGCTGTAGTGCGG - Intronic
1202660455 1_KI270708v1_random:64757-64779 CTGTTGTCCAGGCTGGAGTGTGG - Intergenic
925379986 2:3418004-3418026 CTATTGCCCAGGCTGGAGTGCGG - Intronic
926278423 2:11424479-11424501 CTGTTGTCCAGGCTGTAGTGCGG + Intergenic
926714166 2:15910713-15910735 CTGTTGCCCAGGCTGTAGTGCGG - Intergenic
927478735 2:23433880-23433902 CTATTGCCCAGGCTGGAGTGCGG - Intronic
927629480 2:24760174-24760196 CTTTAGCCCAGGCTGGAGTGTGG + Intronic
927785525 2:25971742-25971764 CTGTTGTCCAGGCTGGAGTGCGG + Intronic
927968571 2:27288482-27288504 CTATGTTCAAGGCTGTTGTGTGG - Intronic
928128897 2:28634872-28634894 CTATTGCCCAGGCTGGAGTGCGG - Intronic
928974200 2:37066904-37066926 CTGTTGTCCAGGCTGGAGTGCGG + Intronic
929089223 2:38198264-38198286 CTAAGGTCAAGGCTGTGCTGTGG - Intergenic
929433780 2:41910908-41910930 CTATTGCCCAGGCTGCAGTGCGG - Intergenic
929578379 2:43066911-43066933 CTATTGCCCAGGCTGGAGTGCGG + Intergenic
929939691 2:46324101-46324123 CTGTAGCCCAGGCTGGAGTGCGG + Intronic
930817243 2:55610900-55610922 CTATCGCCCAGGCTGGAGTGCGG + Intronic
930900440 2:56500481-56500503 CTATCATCTAGGCTGGAGTGTGG + Intergenic
932602936 2:73142614-73142636 CTATCGCCCAGGCTGGAGTGTGG + Intronic
934585575 2:95490766-95490788 CTGTAGCCCAGGCTGGAGTGTGG + Intergenic
934593893 2:95585992-95586014 CTGTAGCCCAGGCTGGAGTGTGG - Intergenic
934788885 2:97039690-97039712 CTGTAGCCCAGGCTGGAGTGTGG + Intergenic
935288937 2:101592759-101592781 CTGTCGTCCAGGCTGGAGTGCGG + Intergenic
935866702 2:107395200-107395222 CTGTCGTCCAGGCTGGAGTGCGG + Intergenic
937693869 2:124786224-124786246 CTATCATCCAGGCTGGAGTGCGG - Intronic
937801959 2:126090897-126090919 CTATTGCCTAGGCTGGAGTGTGG - Intergenic
938029402 2:127979912-127979934 CTGTTGTCCAGGCTGGAGTGTGG + Intronic
938242483 2:129753940-129753962 CTATCGCCCAGGCTGGAGTGCGG - Intergenic
938898367 2:135775801-135775823 CTATTGCCTAGGCTGGAGTGCGG + Intronic
939375449 2:141359717-141359739 CTATAGCCCAGGCTGGAGTGCGG - Intronic
941948661 2:171129796-171129818 CTATATCCCAGGCTGGAGTGCGG - Intronic
941978364 2:171430319-171430341 CTGTTGTCCAGGCTGGAGTGCGG - Intronic
942175195 2:173326505-173326527 CTATCGCCCAGGCTGGAGTGTGG - Intergenic
943165657 2:184321781-184321803 CTGTTGCCAAGGCTGGAGTGCGG - Intergenic
944250468 2:197576043-197576065 CTGTTGTCTAGGCTGGAGTGCGG + Intronic
944640245 2:201717427-201717449 CTGTCGTCCAGGCTGGAGTGTGG - Intronic
944804669 2:203269393-203269415 CTATCATCCAGGCTGGAGTGCGG - Intronic
945539594 2:211068035-211068057 CTGTCGTCCAGGCTGGAGTGCGG - Intergenic
945752108 2:213800401-213800423 CTTTTGTCCAGGCTGGAGTGTGG + Intronic
946347364 2:219121787-219121809 CTATTGCCCAGGCTGGAGTGTGG - Intronic
946467181 2:219922337-219922359 ATATAGCCAAAGCTTTAGTGTGG + Intergenic
946980908 2:225214096-225214118 CTGTAGCCCAGGCTGGAGTGTGG + Intergenic
947143599 2:227042743-227042765 CTATTAACAAGGCTGGAGTGTGG - Intronic
947213806 2:227731794-227731816 CTGTTGCCCAGGCTGTAGTGTGG + Intergenic
947537422 2:230949030-230949052 CTGTTGCCAAGGCTGGAGTGCGG - Intronic
947561566 2:231158271-231158293 CTGTCGTCCAGGCTGCAGTGCGG - Intronic
947916738 2:233837247-233837269 CTATCGCCCAGGCTGGAGTGCGG - Exonic
948044535 2:234933477-234933499 CTATTGCCCAGGCTGGAGTGCGG + Intergenic
948054621 2:235001895-235001917 CTGTTGTCCAGGCTGGAGTGCGG + Intronic
948638064 2:239353038-239353060 CTATCGCCCAGGCTGGAGTGTGG + Intronic
1168760275 20:346088-346110 CTGTTGTCCAGGCTGGAGTGCGG - Intergenic
1168817195 20:746837-746859 CTATTGCCCAGGCTGGAGTGTGG - Intergenic
1169201667 20:3713208-3713230 CTGTCGTCCAGGCTGGAGTGCGG + Intergenic
1169365786 20:4991142-4991164 CTATTGCCCAGGCTGGAGTGCGG + Intronic
1170521793 20:17193561-17193583 CTGTCGTCCAGGCTGGAGTGCGG - Intergenic
1170625747 20:18028754-18028776 CTATTGCCCAGGCTGGAGTGCGG - Intronic
1171001456 20:21420285-21420307 CTATTGCCCAGGCTGGAGTGCGG + Intergenic
1171508254 20:25657519-25657541 CTGTTGTCCAGGCTGGAGTGCGG + Intergenic
1171546330 20:26004663-26004685 CTATTGCCCAGGCTGGAGTGCGG - Intergenic
1171546774 20:26008272-26008294 CTATAGTCCAGGCTGGAGCATGG - Intergenic
1172343466 20:34178143-34178165 CTATCATCCAGGCTGGAGTGCGG - Intergenic
1173896643 20:46556001-46556023 CTGTAGCCCAGGCTGGAGTGTGG - Intergenic
1173931076 20:46819584-46819606 CTGTCGTCCAGGCTGGAGTGCGG + Intergenic
1174261922 20:49302421-49302443 CTGTTGCCCAGGCTGTAGTGTGG + Intergenic
1174590539 20:51641320-51641342 CTGTTGTCCAGGCTGGAGTGGGG - Intronic
1175074564 20:56361630-56361652 CAGTAGTCAAGGTTGTTGTGAGG + Intronic
1175133063 20:56804018-56804040 CTATCGCCCAGGCTGGAGTGCGG + Intergenic
1175696664 20:61107784-61107806 CTGTTGCCCAGGCTGTAGTGCGG - Intergenic
1175850720 20:62090893-62090915 CTGTCGCCCAGGCTGTAGTGCGG + Intergenic
1176523898 21:7850558-7850580 CTATTGCCCAGGCTGGAGTGCGG + Intergenic
1177412805 21:20751922-20751944 CTATTGCCCAGGCTGGAGTGCGG - Intergenic
1177642511 21:23861719-23861741 CTGTTGTCCAGGCTGGAGTGCGG - Intergenic
1178020502 21:28402491-28402513 CTGTAGCCCAGGCTGGAGTGCGG - Intergenic
1178192721 21:30304507-30304529 CTGTCGTCCAGGCTGGAGTGCGG + Intergenic
1178287477 21:31337566-31337588 CTATTGCCCAGGCTGGAGTGCGG + Intronic
1178418121 21:32420331-32420353 CTATTGCCCAGGCTGGAGTGTGG - Intronic
1178643981 21:34369511-34369533 CTGTCGTCCAGGCTGGAGTGGGG - Intronic
1178657918 21:34480570-34480592 CTATTGCCCAGGCTGGAGTGCGG + Intergenic
1178865834 21:36326480-36326502 CTGTTGTCCAGGCTGGAGTGCGG - Intronic
1179218487 21:39386879-39386901 CTGTTGCCAAGGCTGTAGTGTGG + Intronic
1179668089 21:42926202-42926224 CTGTCGTCCAGGCTGGAGTGCGG - Intergenic
1179958680 21:44755968-44755990 CTGTTGTCCAGGCTGGAGTGTGG - Intergenic
1180754320 22:18149881-18149903 CTGTCGTCCAGGCTGGAGTGCGG - Exonic
1180760343 22:18197531-18197553 CAATAGTCAAGGAGGCAGTGGGG - Intergenic
1180770655 22:18381828-18381850 CAATAGTCAAGGAGGCAGTGGGG - Intergenic
1180775326 22:18427165-18427187 CAATAGTCAAGGAGGCAGTGGGG + Intergenic
1180808399 22:18738220-18738242 CAATAGTCAAGGAGGCAGTGGGG + Intergenic
1180828599 22:18884787-18884809 CAATAGTCAAGGAGGCAGTGGGG - Intergenic
1180900009 22:19363864-19363886 CTATTGCCCAGGCTGGAGTGCGG - Intronic
1181071323 22:20343185-20343207 CAATAGTCAAGGAGGCAGTGGGG + Intergenic
1181110881 22:20602243-20602265 CTGTAGCCCAGGCTGCAGTGCGG - Intergenic
1181194397 22:21172134-21172156 CAATAGTCAAGGAGGCAGTGGGG + Intergenic
1181215045 22:21320644-21320666 CAATAGTCAAGGAGGCAGTGGGG - Intergenic
1181453556 22:23039589-23039611 CTGTTGTCCAGGCTGGAGTGTGG - Intergenic
1182384144 22:29921883-29921905 CTATTGCCCAGGCTGGAGTGCGG + Intronic
1182839002 22:33369599-33369621 CTATAGCCCAGACTGGAGTGCGG + Intronic
1183248623 22:36712504-36712526 CTGTGGTCGAGGCTGAAGTGTGG - Intergenic
1183960774 22:41410679-41410701 CTGTTGTCCAGGCTGGAGTGCGG + Intergenic
1184215600 22:43065106-43065128 CTATTGCCCAGGCTGGAGTGCGG - Intronic
1184604994 22:45567577-45567599 CTATCGCCCAGGCTGGAGTGTGG - Intronic
1185045844 22:48528383-48528405 GTATAGCCAAGGCCATAGTGAGG + Intronic
1203232490 22_KI270731v1_random:123000-123022 CAATAGTCAAGGAGGCAGTGGGG - Intergenic
1203278693 22_KI270734v1_random:110775-110797 CAATAGTCAAGGAGGCAGTGGGG - Intergenic
949530370 3:4949357-4949379 CTGTAGCCCAGGCTGGAGTGTGG - Intergenic
949809650 3:7992447-7992469 CTATAATCATGGCTGTATTGAGG - Intergenic
949956262 3:9271295-9271317 CTATTGCCCAGGCTGGAGTGCGG - Intronic
950059972 3:10062745-10062767 CTGTCGCCAAGGCTGGAGTGCGG + Intronic
950085874 3:10257246-10257268 CTGTTGTCCAGGCTGGAGTGCGG - Intronic
950243849 3:11396743-11396765 CTGTAGCCCAGGCTGGAGTGCGG - Intronic
950369479 3:12516386-12516408 CTGTCGTCCAGGCTGGAGTGCGG - Intronic
950376143 3:12573854-12573876 CTGTCGTCCAGGCTGGAGTGCGG - Intronic
951308828 3:21099216-21099238 CTATAGTAAAGCCTGTTGTCAGG - Intergenic
951702849 3:25513248-25513270 CTGTTGTCCAGGCTGGAGTGCGG - Intronic
951935490 3:28018146-28018168 CTATCATCAAGGCTGAAATGAGG + Intergenic
952165555 3:30744675-30744697 CTATTGCCCAGGCTGGAGTGCGG - Intronic
952308353 3:32165167-32165189 CTATCGCCCAGGCTGGAGTGCGG - Intronic
952342719 3:32459259-32459281 CTGTTGTCCAGGCTGGAGTGTGG - Intronic
952766827 3:36961564-36961586 CTATCCCCCAGGCTGTAGTGCGG + Intergenic
953267146 3:41401851-41401873 CTATCGACAAGGATGTAGTAAGG + Intronic
953672181 3:44972424-44972446 CTGTTGTCTAGGCTGGAGTGCGG - Intronic
953841298 3:46392095-46392117 CTATTGTCAAGTTTGTATTGGGG + Intergenic
953990634 3:47480555-47480577 CTATGGTCCAGGCTGGAATGCGG + Intergenic
954007357 3:47602332-47602354 CTATCGCCCAGGCTGGAGTGCGG + Intronic
954282628 3:49593837-49593859 CTATCGCCCAGGCTGGAGTGCGG + Intronic
954547823 3:51454077-51454099 CTCTTGTCAGGGCTGGAGTGCGG + Intronic
955263682 3:57420870-57420892 CTATTGTCCAGGCTGGAGTGCGG - Intronic
955372312 3:58363365-58363387 CTTTTGCCAAGGCTGGAGTGCGG + Intronic
955620807 3:60862213-60862235 CTATTGCCCAGGCTGGAGTGCGG + Intronic
956426534 3:69141366-69141388 CTATAGTCAAGTCTTCAGTAAGG - Intergenic
957315225 3:78568002-78568024 TTATAGTCAAGGATCAAGTGGGG - Intergenic
957800362 3:85070950-85070972 CTATTGCCCAGGCTGGAGTGCGG - Intronic
959696742 3:109256394-109256416 CTATTGCCCAGGCTGGAGTGCGG - Intergenic
959864446 3:111250284-111250306 CTATTGCCCAGGCTGGAGTGCGG - Intronic
960428735 3:117542857-117542879 CTTTAGCCCAGGCTGCAGTGCGG + Intergenic
960595432 3:119403911-119403933 CTATCCCAAAGGCTGTAGTGAGG + Intronic
961765037 3:129203460-129203482 CTGTCGTCCAGGCTGGAGTGTGG + Intergenic
962118256 3:132534607-132534629 CTATTGCCCAGGCTGGAGTGTGG - Intronic
962803904 3:138913660-138913682 CTGTCGTCCAGGCTGGAGTGCGG - Intergenic
962897593 3:139730209-139730231 CTATAGTCAGTGCTGTGGTTTGG + Intergenic
963956513 3:151260384-151260406 CTGTTGTCCAGGCTGGAGTGAGG + Intronic
964056636 3:152469134-152469156 CTATTGTCCAGGCTGGAGTGCGG + Intergenic
965346999 3:167563315-167563337 CTGTAGCCCAGGCTGGAGTGCGG - Intronic
965571285 3:170176187-170176209 CTATCGCCCAGGCTGGAGTGCGG - Intronic
966138035 3:176722968-176722990 ATGTGGTCAAGGCTGCAGTGAGG + Intergenic
966196373 3:177318124-177318146 CTATTGCCCAGGCTGGAGTGCGG + Intergenic
966756718 3:183378230-183378252 CTATAGTCAAGGGAGGGGTGGGG + Intronic
966995457 3:185275769-185275791 CTGTTGTCCAGGCTGGAGTGTGG + Intronic
967043864 3:185718646-185718668 CTGTTGTCCAGGCTGGAGTGCGG - Intronic
967259629 3:187629333-187629355 CTGTAGTCAGGGTTGTAGTGAGG - Intergenic
967918862 3:194599619-194599641 CTATTGTCCAGGCTGGAATGCGG + Intronic
968101898 3:195972234-195972256 CTGTAGCCCAGGCTGGAGTGCGG + Intergenic
968827661 4:2911481-2911503 CTGTTGTCCAGGCTGGAGTGTGG + Intronic
969517714 4:7656811-7656833 TGATCATCAAGGCTGTAGTGGGG - Intronic
970688304 4:18592818-18592840 CTATCGCCCAGGCTGCAGTGCGG - Intergenic
971126885 4:23764112-23764134 CTATCGCCCAGGCTGGAGTGCGG + Intronic
971283399 4:25262513-25262535 CTACAGTGAAGGCTGATGTGAGG - Intronic
971774544 4:30945897-30945919 TTATAGGCAGGGCTGGAGTGTGG - Intronic
971967975 4:33586912-33586934 CTGTCGCCCAGGCTGTAGTGCGG + Intergenic
974293612 4:59966024-59966046 CTGTCGTCCAGGCTGGAGTGCGG + Intergenic
975268489 4:72399394-72399416 CTATTGCCCAGGCTGGAGTGCGG - Intronic
975288312 4:72646205-72646227 CTATCGCCCAGGCTGGAGTGCGG - Intergenic
975568114 4:75781958-75781980 TAATAGTGAAAGCTGTAGTGTGG + Intronic
975585177 4:75941376-75941398 CTATTGCCCAGGCTGGAGTGCGG + Intronic
975948013 4:79731369-79731391 CTATTGCCCAGGCTGGAGTGTGG - Intergenic
975977156 4:80112532-80112554 CTGTGGTCCAGGCTGGAGTGTGG - Intronic
976323172 4:83739289-83739311 CTATTGCCCAGGCTGGAGTGCGG + Intergenic
976364331 4:84215995-84216017 CTATAGTCTAGGCTTTGGAGTGG - Intergenic
976483528 4:85572911-85572933 CTGTAGCCCAGGCTGGAGTGCGG + Intronic
977643015 4:99378428-99378450 CTATTGCCCAGGCTGAAGTGTGG - Intergenic
978010312 4:103674160-103674182 ATATATGAAAGGCTGTAGTGAGG + Intronic
978023902 4:103848531-103848553 CTATGGTCGAGACTGTAGGGAGG - Intergenic
978176958 4:105743693-105743715 CTGTCGTCCAGGCTGGAGTGCGG + Intronic
978798954 4:112736426-112736448 CTGTTGTCCAGGCTGGAGTGCGG - Intergenic
979798455 4:124876525-124876547 CTATTGTCAAGTTTGTATTGGGG + Intergenic
980144543 4:128965866-128965888 CTGTCGTCCAGGCTGCAGTGCGG + Intronic
980421077 4:132562429-132562451 CTGTCGTCCAGGCTGGAGTGCGG + Intergenic
981546351 4:145898116-145898138 CTATAGCCCAGGCTAGAGTGCGG - Intronic
982012487 4:151119573-151119595 CTATCGCCCAGGCTGGAGTGCGG - Intronic
982186824 4:152810777-152810799 CTGTAGCCCAGGCTGGAGTGCGG - Intronic
982513943 4:156320108-156320130 CTATAGCCCAGGCTGGAGTGCGG - Intergenic
983231015 4:165128901-165128923 CTGTCGCCTAGGCTGTAGTGTGG - Intronic
983478564 4:168244686-168244708 CTATAGCCCAGGCTGGAGTGCGG - Intronic
984392226 4:179150721-179150743 CTATCGCCCAGGCTGGAGTGCGG - Intergenic
987302367 5:16607914-16607936 CTGTCGTCCAGGCTGGAGTGGGG + Intronic
988588404 5:32527750-32527772 ATATAGTCAAAGAGGTAGTGTGG - Intergenic
988673931 5:33411551-33411573 CTATACTCAAAGCTGAAGTTTGG + Intergenic
989108761 5:37887409-37887431 CTGTCGCCCAGGCTGTAGTGCGG - Intergenic
989554543 5:42778069-42778091 TTATAGTTAAGGTTGTAGAGGGG + Intronic
990403163 5:55460807-55460829 CTGTTGTCCAGGCTGGAGTGCGG - Intronic
991492302 5:67195251-67195273 CTGTCGCCAAGGCTGGAGTGCGG + Intronic
991710892 5:69407611-69407633 CTGTTGTCCAGGCTGGAGTGCGG + Intronic
992040164 5:72822950-72822972 CTCTTGTCCAGGCTGGAGTGGGG + Intronic
992162271 5:74015144-74015166 CTATCATCTAGGCTGGAGTGCGG + Intergenic
992208627 5:74455359-74455381 GAAAGGTCAAGGCTGTAGTGAGG + Intergenic
992323766 5:75640078-75640100 CTGTTGTCTAGGCTGGAGTGTGG + Intronic
992490594 5:77240188-77240210 CTATTGCCCAGGCTGGAGTGCGG + Intronic
992569728 5:78043170-78043192 CTGTCGTCCAGGCTGGAGTGCGG + Intronic
992656687 5:78917547-78917569 CTATCATCCAGGCTGGAGTGTGG + Intronic
992683828 5:79180313-79180335 CTGTTGCCCAGGCTGTAGTGCGG - Intronic
992686824 5:79207443-79207465 CTATTGCCCAGGCTGGAGTGTGG - Intronic
992890127 5:81196217-81196239 CTATTGCCCAGGCTGGAGTGTGG - Intronic
993762084 5:91807943-91807965 CTATCATCCAGGCTGGAGTGTGG + Intergenic
995490837 5:112690274-112690296 CTATAGCCCAGGCTCTAGGGTGG - Intergenic
995618246 5:113991662-113991684 CTATCGCCCAGGCTGGAGTGCGG - Intergenic
995971972 5:117983478-117983500 CTGTTGTCCAGGCTGGAGTGCGG - Intergenic
995991303 5:118243076-118243098 GTATAGTCAAGGATGTAGGTTGG + Intergenic
996827487 5:127702127-127702149 CTGTAGCCCAGGCTGGAGTGCGG + Intergenic
996867455 5:128142137-128142159 CTGTCGCCCAGGCTGTAGTGCGG + Intronic
996877042 5:128251415-128251437 CTGTTGTCCAGGCTGGAGTGCGG + Intergenic
997159141 5:131588704-131588726 CTGTTGCCAAGGCTGGAGTGCGG - Intronic
997316171 5:132938300-132938322 CTATCATCCAGGCTGGAGTGCGG + Intronic
997483782 5:134211128-134211150 CTGTTGTCCAGGCTGCAGTGCGG + Intronic
997543953 5:134689725-134689747 CTGTCGTCCAGGCTGGAGTGCGG - Intronic
998066900 5:139166679-139166701 CCATAGCCCAGGCTGGAGTGCGG + Intronic
998447524 5:142210226-142210248 CTGTCGTCCAGGCTGAAGTGCGG - Intergenic
998623012 5:143815284-143815306 CTATAGTCAAGGTGTCAGTGGGG + Intronic
999711628 5:154323333-154323355 CTGTTGTCCAGGCTGGAGTGTGG - Intronic
1000681061 5:164185112-164185134 CACTAGAAAAGGCTGTAGTGAGG - Intergenic
1000795022 5:165654378-165654400 CTATTGTCCAGGCTGGAGTGCGG - Intergenic
1001292905 5:170477471-170477493 CTGTAGCCCAGGCTGGAGTGCGG + Intronic
1003076533 6:2988138-2988160 CTGAAGTCAAGGGTGTGGTGAGG + Intronic
1003250460 6:4425110-4425132 CTGTTGTCCAGGCTGGAGTGCGG - Intergenic
1003906685 6:10706853-10706875 CTATCGCCCAGGCTGGAGTGCGG - Intronic
1004120797 6:12820216-12820238 CTGTTGCCAAGGCTGGAGTGCGG + Intronic
1004216268 6:13706967-13706989 CTATCGTCCAGGCTGGAGTGCGG - Intronic
1004446183 6:15700938-15700960 AGAAAGTCAAGGCTGCAGTGAGG + Intergenic
1004603297 6:17171299-17171321 CTGTTGTCTAGGCTGGAGTGTGG - Intergenic
1004621208 6:17332204-17332226 CTGTTGTCCAGGCTGGAGTGCGG + Intergenic
1004712014 6:18180600-18180622 CTATTGCCCAGGCTGGAGTGCGG + Intronic
1005780124 6:29182177-29182199 CTATTGCCCAGGCTGTACTGAGG + Intergenic
1006554551 6:34854183-34854205 CTATTGCCCAGGCTGGAGTGCGG - Intronic
1007210697 6:40191644-40191666 CTAAAGTCATGGCTAAAGTGGGG - Intergenic
1007566541 6:42855503-42855525 CTGTCGTCCAGGCTGGAGTGTGG - Intronic
1009021460 6:57951561-57951583 CTGTGGCCCAGGCTGTAGTGTGG - Intergenic
1010965182 6:82197405-82197427 CTATTGCCCAGGCTGGAGTGCGG + Intronic
1011507136 6:88057972-88057994 CTATAGTTGAGGCTGTCCTGTGG + Intronic
1013100771 6:106984568-106984590 CTAAGGTCGAGGCTGCAGTGAGG + Intergenic
1014637500 6:123866465-123866487 CTGTCGTCCAGGCTGGAGTGCGG + Intronic
1014766712 6:125415556-125415578 CTGTCGTCCAGGCTGGAGTGTGG + Intergenic
1014811962 6:125896753-125896775 CTTTTGTCAAGGTTGGAGTGCGG - Intronic
1015027173 6:128548879-128548901 CTATCGCCCAGGCTGGAGTGCGG - Intergenic
1015407289 6:132852125-132852147 CTATCGCCCAGGCTGAAGTGTGG - Intergenic
1015543453 6:134339064-134339086 CTGTAGCCCAGGCTGGAGTGTGG + Intergenic
1015781036 6:136865739-136865761 CTATTGCCCAGGCTGGAGTGCGG - Intronic
1015946880 6:138511869-138511891 CTATTGCCCAGGCTGGAGTGCGG - Intronic
1016024128 6:139268111-139268133 CTGTCGTCCAGGCTGGAGTGCGG - Intronic
1016966030 6:149719207-149719229 CTGTCGTCCAGGCTGGAGTGCGG - Intergenic
1017145829 6:151233813-151233835 CTGTCGTCCAGGCTGGAGTGTGG - Intergenic
1017199437 6:151736407-151736429 CTGTAGCCCAAGCTGTAGTGTGG + Intronic
1017445241 6:154501797-154501819 CCATAGTCCCGGCTTTAGTGTGG - Intronic
1017773554 6:157662216-157662238 CTGTCGCCCAGGCTGTAGTGCGG + Intronic
1019325134 7:434363-434385 CTGTCGTCCAGGCTGGAGTGCGG + Intergenic
1019368628 7:648572-648594 CTGTTGTCCAGGCTGGAGTGCGG - Intronic
1019429871 7:993738-993760 CTGTCGTCCAGGCTGGAGTGCGG - Intergenic
1019985696 7:4653979-4654001 CTTTTGTCCAGGCTGGAGTGTGG + Intergenic
1020072933 7:5239370-5239392 CTGTCGTCCAGGCTGGAGTGCGG - Intergenic
1020126805 7:5537475-5537497 CTATAGCCCAGGCTGGAGTGCGG - Intronic
1020797277 7:12691502-12691524 CTCTTGCCCAGGCTGTAGTGCGG + Intergenic
1022355463 7:29610553-29610575 CTATTGCCCAGGCTGGAGTGCGG + Intergenic
1022415843 7:30176341-30176363 CTGTTGCCCAGGCTGTAGTGCGG - Intergenic
1023089877 7:36607868-36607890 CTATAATGAGGGCTGTTGTGGGG + Intronic
1023171127 7:37391151-37391173 CTATTGTCCAGGCTGGAGCGTGG + Intronic
1023781698 7:43661598-43661620 CTATCGCCCAGGCTGGAGTGCGG - Intronic
1023867727 7:44246288-44246310 CTATTGCCCAGGCTGGAGTGCGG + Intronic
1024478535 7:49839955-49839977 CTAAAGTCAAAGCTGTGGCGAGG + Intronic
1024947264 7:54821301-54821323 CTATTGCCTAGGCTGGAGTGTGG - Intergenic
1025143162 7:56482721-56482743 CTGTAGCCCAGGTTGTAGTGCGG - Intergenic
1025174708 7:56792854-56792876 CTATTGCCCAGGCTGGAGTGCGG + Intergenic
1025697096 7:63783560-63783582 CTATTGCCCAGGCTGGAGTGCGG - Intergenic
1025929739 7:65983941-65983963 CTGTAGCCCAGGCTGGAGTGCGG - Intergenic
1025957163 7:66191910-66191932 CTGTTGTCCAGGCTGGAGTGTGG - Intergenic
1025977746 7:66382396-66382418 CTGTTGTCCAGGCTGGAGTGCGG - Intronic
1026009454 7:66625484-66625506 CTATTGCCCAGGCTGGAGTGTGG - Intergenic
1026106719 7:67427024-67427046 CTGTAGCCCAGGCTGGAGTGTGG + Intergenic
1026309286 7:69169846-69169868 CTGAAGTCAAGGCTGTTCTGGGG - Intergenic
1026496263 7:70906326-70906348 CTATTGTCCAGGCTGGAGTGTGG + Intergenic
1026653871 7:72239357-72239379 CTGTTGTCCAGGCTGGAGTGCGG - Intronic
1026680416 7:72462496-72462518 CTTTAGTCAAGGCTGGTGTGCGG + Intergenic
1027227327 7:76252032-76252054 CTGTTGCCAAGGCTGTAGTGTGG - Intronic
1027270729 7:76517136-76517158 CTATTGTCCAGGCTGGAGTGCGG - Intergenic
1027377837 7:77572129-77572151 CTGTAGCCCAGGCTGGAGTGCGG + Intronic
1029236308 7:99122289-99122311 CTATTGCCCAGGCTGGAGTGCGG - Intronic
1029265469 7:99335915-99335937 CTGTTGCCAAGGCTGGAGTGCGG - Intronic
1029579138 7:101423696-101423718 CTGTCGCCCAGGCTGTAGTGCGG - Intronic
1029590990 7:101506949-101506971 CTATTGCCCAGGCTGGAGTGTGG + Intronic
1030026508 7:105329555-105329577 CTGTCGTCCAGGCTGGAGTGCGG - Intronic
1030193295 7:106830714-106830736 CTATTGTCAAGTTTGTATTGGGG - Intergenic
1030403305 7:109080011-109080033 CTGTTGTCCAGGCTGGAGTGTGG + Intergenic
1030472055 7:109977120-109977142 CTTCAGTCAAAGCTGTAGTTTGG + Intergenic
1031110551 7:117603136-117603158 ATATTGTCCAGGCTGGAGTGCGG - Intronic
1031270219 7:119639463-119639485 CTGTAGCCCAGGCTGGAGTGCGG - Intergenic
1032067990 7:128786558-128786580 CTATTGCCCAGGCTGGAGTGCGG + Intergenic
1032112117 7:129084977-129084999 CTATCGCCCAGGCTGGAGTGCGG - Intergenic
1032249389 7:130241461-130241483 CTGTAGCCCAGGCTGGAGTGTGG + Intergenic
1032646527 7:133830999-133831021 CTATCGCCCAGGCTGGAGTGTGG + Intronic
1032715465 7:134505472-134505494 CTGTCGCCCAGGCTGTAGTGTGG - Intergenic
1033119443 7:138653894-138653916 CTGTCGTCCAGGCTGGAGTGTGG - Intronic
1033134801 7:138775511-138775533 CTGTTGTCCAGGCTGGAGTGTGG + Intronic
1033644820 7:143292972-143292994 CTGTTGGCAAGGCTGGAGTGCGG - Intronic
1033739308 7:144257432-144257454 CTATAGCCCAGGCTGGAGTGCGG - Intergenic
1033799044 7:144879203-144879225 CTATTGCCCAGGCTGGAGTGCGG - Intergenic
1033799763 7:144886997-144887019 CTATTGCCCAGGCTGGAGTGTGG + Intergenic
1034173456 7:149081397-149081419 CTGTCGCCCAGGCTGTAGTGCGG - Intronic
1034190376 7:149208982-149209004 CTGTAGCCCAGGCTGGAGTGCGG - Intronic
1034558353 7:151863865-151863887 CTGTAGTCCAGGCTGGAGTGCGG - Intronic
1035398997 7:158552460-158552482 CTGTAGCCTAGGCTGGAGTGCGG + Intronic
1035584665 8:762704-762726 CTCTAGCCCAGGCTGGAGTGCGG + Intergenic
1035886884 8:3300920-3300942 CTGTTGTCCAGGCTGGAGTGCGG - Intronic
1036904995 8:12700664-12700686 CTGTAGCCCAGGCTGGAGTGCGG + Intergenic
1037253870 8:16929291-16929313 CTATAGTCTACTCTGTAGTCAGG - Intergenic
1037401585 8:18499724-18499746 CTGTAGCCCAGGCTGGAGTGTGG - Intergenic
1037428350 8:18782485-18782507 TTTTAGTAACGGCTGTAGTGAGG + Intronic
1037529717 8:19760616-19760638 CTATTGCCCAGGCTGGAGTGTGG - Intergenic
1037778510 8:21851371-21851393 CTGTTGCCCAGGCTGTAGTGCGG - Intergenic
1037780012 8:21861497-21861519 CTGTAGCCCAGGCTGGAGTGTGG - Intergenic
1037797366 8:22007586-22007608 CTACACTCAGGGCTGTAATGAGG - Intergenic
1037798484 8:22016970-22016992 CTGCAGTCCAGGCTGGAGTGTGG - Intergenic
1038704062 8:29877660-29877682 CTATACTGAAGGCTGGAGGGAGG + Intergenic
1039317229 8:36387108-36387130 CTAAAGTCAAGTCAGAAGTGAGG - Intergenic
1039990122 8:42480694-42480716 CTGTTGTCTAGGCTGGAGTGCGG + Intronic
1041080491 8:54210722-54210744 CTGTTGTCCAGGCTGGAGTGCGG + Intergenic
1041104642 8:54429307-54429329 CTATTGCCCAGGCTGGAGTGTGG - Intergenic
1041370316 8:57152847-57152869 CTATCGCCCAGGCTGGAGTGCGG + Intergenic
1042076173 8:64997635-64997657 CTGTAGCCCAGGCTGGAGTGCGG + Intergenic
1042124995 8:65529264-65529286 CTATTGCCCAGGCTGGAGTGTGG - Intergenic
1042302652 8:67302160-67302182 CTGTTGTCCAGGCTGGAGTGCGG - Intronic
1042304864 8:67320917-67320939 CTATTGCCCAGGCTGAAGTGCGG - Intronic
1042649376 8:71023421-71023443 TCTTAGTGAAGGCTGTAGTGAGG + Intergenic
1044424351 8:92033930-92033952 CTATTGCCCAGGCTGGAGTGCGG - Intronic
1044673929 8:94711100-94711122 CTGTAGCCCAGGCTGTAGTACGG + Intergenic
1044964054 8:97557839-97557861 CTGTTGTCCAGGCTGGAGTGTGG - Intergenic
1045449338 8:102305785-102305807 CTGTCTTCCAGGCTGTAGTGCGG + Intronic
1045947389 8:107811720-107811742 CTGTTGCCAAGGCTGGAGTGGGG - Intergenic
1046212344 8:111093537-111093559 CAAAAGTTAAGGCTGTAGTGAGG + Intergenic
1046511953 8:115213625-115213647 CTACTGTCAAGGTTGTATTGGGG - Intergenic
1046943178 8:119950998-119951020 GGAAAGTCAAGGCTGCAGTGAGG + Intronic
1047334648 8:123923901-123923923 CTGTAGTCCAGGCTGGAGCGCGG - Intronic
1048812228 8:138299021-138299043 CTATCGCCCAGGCTGGAGTGCGG - Intronic
1048812303 8:138300002-138300024 CTATCGCCCAGGCTGGAGTGCGG + Intronic
1049086907 8:140485878-140485900 CTGTTGTCCAGGCTGGAGTGCGG - Intergenic
1049132150 8:140855556-140855578 CTGTTGTCCAGGCTGGAGTGTGG - Intronic
1049328412 8:142036599-142036621 CTATTGCCCAGGCTGGAGTGTGG - Intergenic
1049827671 8:144679941-144679963 CTGTCGTCCAGGCTGGAGTGCGG - Intergenic
1050741713 9:8827568-8827590 CTATTGCCCAGGCTGGAGTGTGG - Intronic
1050841050 9:10149765-10149787 CTGTCGTCCAGGCTGGAGTGCGG + Intronic
1053798033 9:41743885-41743907 CTATAGTCCAGGCTGGAGCATGG + Intergenic
1054186446 9:61955937-61955959 CTATAGTCCAGGCTGGAGCATGG + Intergenic
1054466903 9:65502110-65502132 CTATAGTCCAGGCTGGAGCATGG - Intergenic
1054652058 9:67632583-67632605 CTATAGTCCAGGCTGGAGCATGG - Intergenic
1054784802 9:69200422-69200444 GTATTGCCAAGGCTGGAGTGTGG + Intronic
1054799815 9:69335909-69335931 AGAAAGTCAAGGCTGCAGTGAGG + Intronic
1055437611 9:76308158-76308180 CTGTAGCCCAGGCTGGAGTGTGG - Intronic
1055492444 9:76819211-76819233 CTGTTGCCCAGGCTGTAGTGCGG - Intronic
1055528065 9:77155241-77155263 CTATTGTCCAGGCTGGATTGCGG - Intergenic
1055536284 9:77248766-77248788 CTATTGTCCAGGCTGGAGTGCGG + Intronic
1055814600 9:80189644-80189666 CTATTGTCGAGGCTGGAGTGTGG + Intergenic
1055994282 9:82140837-82140859 CTGTCGCCCAGGCTGTAGTGCGG + Intergenic
1056370180 9:85946212-85946234 CTATAGTCAAGGCTGTAGTGAGG - Intronic
1057256176 9:93549004-93549026 CTGTGGTCCAGGCTGGAGTGCGG - Intronic
1058335908 9:103828798-103828820 CTATCACCAAGGCTGGAGTGTGG + Intergenic
1058621858 9:106891689-106891711 CTATAATCAAGGGTGTGGAGAGG - Intronic
1058656001 9:107221039-107221061 CTGTAGCCCAGGCTGGAGTGCGG - Intergenic
1058688973 9:107503308-107503330 CTATCGCCAAGGCTGGAGTGTGG + Intergenic
1058946628 9:109863261-109863283 CAATACTCAAGGTTATAGTGGGG + Intronic
1059184757 9:112257901-112257923 TTATAGCCCAGGCTGGAGTGTGG - Intronic
1059771074 9:117426421-117426443 CTGTAGTCAAGGCTGTGATGAGG + Intergenic
1060082612 9:120665240-120665262 CTGTAGCCTAGGCTGGAGTGTGG + Intronic
1060142630 9:121223694-121223716 CTGTTGTCTAGGCTGGAGTGCGG + Intronic
1060640386 9:125233373-125233395 CTGTCGCCCAGGCTGTAGTGCGG + Intronic
1061236653 9:129347012-129347034 CTCTCGTCCAGGCTGGAGTGCGG + Intergenic
1061961065 9:133989481-133989503 CTATTGCCCAGGCTGGAGTGCGG - Intronic
1185546041 X:946570-946592 CTTTAGTGTAGGCTGTAGTTTGG - Intergenic
1185703539 X:2249558-2249580 CTGTAGCCCAGGCTGGAGTGCGG + Intronic
1185723762 X:2402917-2402939 CTGTAGTCCAGGTTGGAGTGCGG + Intronic
1185766626 X:2730891-2730913 CTGTTGTCCAGGCTGGAGTGTGG - Intronic
1186147289 X:6637506-6637528 CTGTTGTCAAGGCTGAAGTACGG - Intergenic
1186767434 X:12785445-12785467 CTATCTTCCAGGCTGGAGTGCGG + Intergenic
1187761825 X:22595831-22595853 CTGTAGCCCAGGCTGGAGTGTGG + Intergenic
1188009856 X:25044068-25044090 CTGTCGTCCAGGCTGGAGTGCGG + Intergenic
1189784979 X:44551214-44551236 CTGTTGCCCAGGCTGTAGTGAGG + Intergenic
1190057706 X:47191277-47191299 CTAAAGTCAAGGCGGGACTGGGG + Intronic
1190126305 X:47708638-47708660 CTGTAGTCCAGGCTGGAGAGCGG - Intergenic
1190242793 X:48670956-48670978 CTGTAGCCTAGGCTGGAGTGCGG + Intergenic
1190377915 X:49808142-49808164 CTGTTGTCCAGGCTGGAGTGCGG + Intergenic
1190725486 X:53187794-53187816 CTGTAGCCCAGGCTGGAGTGCGG + Intergenic
1190858055 X:54316501-54316523 CTATTGCCCAGGCTGGAGTGCGG - Intronic
1192485091 X:71518204-71518226 CTATTGCCCAGGCTGGAGTGCGG + Intronic
1192778869 X:74273760-74273782 CTGTTGTCCAGGCTGGAGTGTGG - Intergenic
1192882231 X:75298013-75298035 CTATTGTCCAGGCTGGAGTATGG + Intronic
1195547093 X:106124908-106124930 CTATAGTCATGGTTATATTGGGG + Intergenic
1195662904 X:107398808-107398830 CTATTGCCCAGGCTGGAGTGCGG + Intergenic
1196100202 X:111839751-111839773 CTGTTGTCCAGGCTGGAGTGTGG + Intronic
1197204309 X:123776782-123776804 CTGTAGCCCAGGCTGGAGTGCGG + Intergenic
1199539664 X:148945079-148945101 CTATATCCATGGCCGTAGTGGGG - Intronic
1200298483 X:154947186-154947208 CTGTAGCCCAGGCTGGAGTGCGG - Intronic
1200968561 Y:9125481-9125503 CTATCGCCCAGGCTGGAGTGCGG + Intergenic
1202055897 Y:20829129-20829151 CTGTAGCCCAGGCTGGAGTGCGG + Intergenic