ID: 1056372310

View in Genome Browser
Species Human (GRCh38)
Location 9:85968770-85968792
Sequence TTAGATTACTAGTTGGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 108}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056372310_1056372315 -2 Left 1056372310 9:85968770-85968792 CCTTGCCCCAACTAGTAATCTAA 0: 1
1: 0
2: 0
3: 4
4: 108
Right 1056372315 9:85968791-85968813 AAAAGCTGGTTAAATCATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056372310 Original CRISPR TTAGATTACTAGTTGGGGCA AGG (reversed) Intronic
901708122 1:11091978-11092000 TTAGGTAATTAGGTGGGGCACGG - Intronic
902220586 1:14962046-14962068 TTAGAGTCCTAGCTGGGACAAGG - Intronic
902420669 1:16277397-16277419 ATATATTAGTAGTGGGGGCAGGG - Intronic
907017246 1:51028914-51028936 TGAGACTACTAGAGGGGGCAGGG - Intergenic
909615430 1:77603372-77603394 TTGTATTAATAGTTGGGGCCAGG - Intronic
909728547 1:78866083-78866105 TTGTATTTCTAGTTGAGGCAGGG + Intergenic
909952582 1:81737158-81737180 AAAGATTACTAGTTGGAGCCTGG - Intronic
911040020 1:93583933-93583955 TGAGACAACTAGATGGGGCAGGG + Intronic
911459153 1:98167337-98167359 TTCAATTTCTACTTGGGGCAAGG + Intergenic
918673099 1:187245492-187245514 TTAGATTACTAATAGAGGTAAGG - Intergenic
919298441 1:195732232-195732254 TGACATTCCTGGTTGGGGCAGGG - Intergenic
921484154 1:215696711-215696733 TTAAATTACAAATGGGGGCATGG + Intronic
1070110557 10:73483145-73483167 TTAGATAACTAACTGTGGCATGG - Intronic
1070500547 10:77068967-77068989 TGAGGTTTCAAGTTGGGGCATGG - Intronic
1073192246 10:101659998-101660020 TTATATTACAAGTTAGGGCCGGG - Intronic
1073718584 10:106138935-106138957 TAAGTTTACTAGGTTGGGCATGG - Intergenic
1079004469 11:16782344-16782366 TTGGATTTCTTGCTGGGGCAAGG - Intronic
1079302531 11:19290951-19290973 TTGGGTTACTTGCTGGGGCAGGG - Intergenic
1082061187 11:47861519-47861541 TTGGTTTATTAGTTTGGGCATGG - Intergenic
1085122069 11:73973678-73973700 TTGGATGCCTAGCTGGGGCAGGG + Intergenic
1085854138 11:80157053-80157075 TTAGATTAATATTTGGTTCAGGG + Intergenic
1089761641 11:120730062-120730084 TGAGTTCACTAGGTGGGGCACGG + Intronic
1090215125 11:124954845-124954867 CTATAGTACCAGTTGGGGCATGG + Exonic
1092436500 12:8451257-8451279 GTGGATTACTAGTTGGGAGAGGG + Intergenic
1093114559 12:15193456-15193478 TTAGATTCAAGGTTGGGGCATGG - Intronic
1094032313 12:26026606-26026628 TTATATTTTTAGTTGGGACAGGG + Intronic
1094253418 12:28393641-28393663 TTAGTTTACTACTTGCTGCAAGG + Intronic
1095756037 12:45768347-45768369 CTGGATTACAAGCTGGGGCATGG - Intronic
1096066069 12:48741811-48741833 TTTGATTTCTAGTAGAGGCAAGG + Intergenic
1110882551 13:80590069-80590091 TTAGAATACTATCTGTGGCATGG - Intergenic
1116255651 14:42551025-42551047 TTAGATTTTTAGTAGAGGCAGGG - Intergenic
1117186929 14:53249407-53249429 TAATATTACAAGTTGGGGCTTGG - Intergenic
1119842199 14:77801642-77801664 TAAGAATATTAGTTGGGGCCGGG + Intronic
1120587568 14:86332541-86332563 TTAAATTATTAGTTGAGGGAGGG - Intergenic
1121594805 14:95153643-95153665 TTAGATGAATGATTGGGGCAAGG - Intronic
1122011357 14:98751561-98751583 CTAGATCTCTAGGTGGGGCAAGG + Intergenic
1125489283 15:40135013-40135035 TTAGATTAATAGTGGGGGGTAGG + Intergenic
1125886325 15:43232414-43232436 TTACATTTCTAGTGGAGGCAGGG - Intergenic
1129077570 15:73010279-73010301 ATAGTTTACCAGTTGGGGGAGGG - Intergenic
1130057527 15:80540650-80540672 TGGGATTACTAGATGGGGGAAGG - Intronic
1139767171 16:69240670-69240692 AAAGATCACCAGTTGGGGCATGG + Intronic
1145917684 17:28585525-28585547 TTAAATTACCAGTTGGGTCTGGG + Exonic
1147547467 17:41413671-41413693 CTAGATGACTAGTTGGAGGAAGG - Intergenic
1153227868 18:2911595-2911617 TGACATTCCTAGTTGGGGTAGGG + Intronic
1155938370 18:31777676-31777698 GTAGATTGCTATTTGGAGCAGGG + Intergenic
1156741022 18:40327878-40327900 TTAGATTTCTAGTTGAGGGAAGG + Intergenic
1158505050 18:58040234-58040256 TTGGATTACTAGGTTGGGCTAGG + Intergenic
1164430453 19:28183671-28183693 TTTGATTATTAGTTGGGACTGGG - Intergenic
1164967520 19:32498296-32498318 TTAGTTAACTCTTTGGGGCATGG - Intergenic
1165016293 19:32882653-32882675 TTAGGTTACCAGTTGATGCAGGG - Intronic
925397327 2:3544535-3544557 CAGGATTACTTGTTGGGGCAAGG + Intronic
926383356 2:12313172-12313194 TTAGATTTGTGGTGGGGGCAGGG - Intergenic
927367747 2:22318683-22318705 TTAGAATACTAGTAGGGGCCAGG + Intergenic
931039274 2:58278913-58278935 TTGTATTACTAGTAGTGGCAGGG + Intergenic
937779664 2:125822667-125822689 TAAGAATACTACTTCGGGCAGGG - Intergenic
938593623 2:132764483-132764505 GTAGATTAGTAGCTTGGGCAAGG - Intronic
939564543 2:143771561-143771583 TTCAATTACTAGTTGTGGCATGG - Intergenic
944484498 2:200190723-200190745 TTTGATTACAAGTAAGGGCATGG + Intergenic
948633608 2:239318630-239318652 CTGGATTATTAGTTGGGGGAAGG + Intronic
1170667428 20:18398957-18398979 TTATATTATTAGTAGAGGCAGGG - Intronic
1177571465 21:22892429-22892451 TTGGTGTACTAGTTGGTGCAGGG + Intergenic
1181119389 22:20655440-20655462 TTAGATTTCTAGGTGAGGCCTGG - Intergenic
1182543554 22:31059187-31059209 TTGCATTACTAGTAGAGGCAGGG + Intergenic
1182686816 22:32127341-32127363 TTAGATTTCTAGGTGAGGCCTGG + Intergenic
960327186 3:116312191-116312213 TTAGTTTATTTGTTGGGGGAGGG - Intronic
963082530 3:141407665-141407687 GTAGATTCCCAGGTGGGGCAAGG + Intronic
963478060 3:145831938-145831960 TTATATTTTTAGTTGAGGCAGGG - Intergenic
964610657 3:158611634-158611656 GTAGAATAGTAGGTGGGGCACGG - Intergenic
965320059 3:167242811-167242833 TGAGATTCCAAATTGGGGCATGG + Intronic
967846320 3:194045839-194045861 TAAGATTTCTACTTGGGGCCGGG - Intergenic
967903203 3:194478211-194478233 TTAGACCACTAGTTGGCACATGG - Intronic
969475547 4:7420680-7420702 CTAGCTTGCTAGATGGGGCACGG - Intronic
975974308 4:80077646-80077668 TTAGTTTATTTGTTGGGGTATGG - Intronic
976492400 4:85686935-85686957 TAAGATTACTACATTGGGCAAGG - Intronic
976851513 4:89552192-89552214 TTAGAATACCAGTTGAGTCAAGG + Intergenic
978074471 4:104511978-104512000 TTGGTTTACTGTTTGGGGCATGG - Intergenic
979826355 4:125238583-125238605 TTAGAATACTAGTAGGGAGAAGG - Intergenic
982720653 4:158856077-158856099 TTTGATTACTGGATGGGGAATGG + Intronic
987742176 5:21924230-21924252 TTAAATTACTAGCTGTGGCCGGG + Intronic
988799904 5:34686793-34686815 TTGGATTACAACTTGGGTCATGG - Intronic
989526961 5:42464729-42464751 TTAGATTATTAGTTCTGCCAGGG - Intronic
992401569 5:76416698-76416720 TTGTATTACTAGTAGGGACAGGG + Intronic
993394276 5:87363739-87363761 AAAGATTGCTTGTTGGGGCAGGG - Intronic
999501443 5:152150553-152150575 TGAGATTACTAAGTAGGGCAAGG + Intergenic
1001310867 5:170609543-170609565 TTAGAGTACTAGTTTGGGCCTGG + Intronic
1003989412 6:11470957-11470979 TTGTATTATTAGTTGAGGCAGGG + Intergenic
1004439769 6:15638411-15638433 TAAAATTACTAATTGGGGCCAGG - Intronic
1005123737 6:22421086-22421108 TTATATTACTTGTTTGGACAAGG + Intergenic
1008060222 6:46989341-46989363 TTAAATTAGTTGTTGGGGAAGGG + Intergenic
1008639619 6:53448450-53448472 TTATATTATTAGGAGGGGCAGGG - Intergenic
1008713284 6:54256051-54256073 TTAGATTTCTAGTTGGCTCTAGG + Intronic
1013569665 6:111408973-111408995 TAAAATTAGTAGGTGGGGCACGG - Intronic
1018775607 6:167012328-167012350 TGAGATTTCTAGTTGGTGTAGGG + Intronic
1020347245 7:7179166-7179188 TAGGATTACTTGTTGGGGCCAGG - Intronic
1023353663 7:39345459-39345481 TTGGATAACAAATTGGGGCAAGG + Intronic
1026198736 7:68195643-68195665 TTGGATTTCTAGTAGAGGCAGGG - Intergenic
1032677662 7:134146099-134146121 TTGTATTTCTAGTTGAGGCAGGG - Intronic
1037274717 8:17165645-17165667 TTACATTTCTAATTGGGGGAAGG + Intronic
1037798951 8:22020964-22020986 TTATATTTATATTTGGGGCAGGG - Intergenic
1038128608 8:24703285-24703307 TTAGATTACTAGTTGCTTCTTGG - Intergenic
1042985083 8:74574426-74574448 TAAGATTACTAGATTGGGGATGG - Intergenic
1043784200 8:84376624-84376646 TTTGATTACTAGATGGAACAGGG + Intronic
1045566742 8:103324656-103324678 TTAAAATACATGTTGGGGCATGG - Exonic
1056372310 9:85968770-85968792 TTAGATTACTAGTTGGGGCAAGG - Intronic
1056857129 9:90141275-90141297 TTAGAGTACTATCAGGGGCACGG - Intergenic
1058031574 9:100204212-100204234 TTAGATAACTAGTTAGAGCCAGG + Intronic
1058336774 9:103838911-103838933 TTAGATTACTATTAGAGGCCTGG - Intergenic
1186866025 X:13721759-13721781 TTAAAATGCTATTTGGGGCAGGG + Intronic
1188288005 X:28352641-28352663 TTAGCAAACAAGTTGGGGCATGG + Intergenic
1190860665 X:54341766-54341788 ATAGATTAGTGGTTGGGGCTGGG + Intronic
1195491355 X:105473929-105473951 TTTGATTACTTCTTGTGGCATGG + Intronic
1196910117 X:120476514-120476536 TTAAAACACTAGTTGGGGCCGGG + Intergenic
1199982829 X:152930189-152930211 TCATTGTACTAGTTGGGGCAGGG + Intronic