ID: 1056378943

View in Genome Browser
Species Human (GRCh38)
Location 9:86040135-86040157
Sequence CAATTTCAGAACATTTTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 577
Summary {0: 1, 1: 0, 2: 7, 3: 51, 4: 518}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056378943_1056378945 -10 Left 1056378943 9:86040135-86040157 CCAATAAAAATGTTCTGAAATTG 0: 1
1: 0
2: 7
3: 51
4: 518
Right 1056378945 9:86040148-86040170 TCTGAAATTGACTGTGGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056378943 Original CRISPR CAATTTCAGAACATTTTTAT TGG (reversed) Intronic
900343736 1:2200946-2200968 CCAGTTCAGCACGTTTTTATGGG + Intronic
901257889 1:7847569-7847591 AATTTTCAGGACATGTTTATAGG + Intronic
905712987 1:40123126-40123148 CAATTTCACAACATGTTCACAGG + Intergenic
906958796 1:50401198-50401220 CAATTTCAGAGCTTGTTAATTGG - Intergenic
907468464 1:54655321-54655343 GATTTTCAGAACAATTTTAAAGG - Intronic
907765045 1:57401238-57401260 CAATTTCACAACAACTATATAGG + Intronic
907990866 1:59581305-59581327 CTAGTTGAGAACATTTCTATTGG + Intronic
908992883 1:70114788-70114810 CATTTCCTCAACATTTTTATTGG - Intronic
909279221 1:73727411-73727433 CAATTTAGGAATGTTTTTATGGG + Intergenic
910086567 1:83410347-83410369 CAATTTTAGTACTGTTTTATGGG + Intergenic
910335704 1:86127973-86127995 TAATTTCATGACATTTTTAAAGG + Intronic
910555437 1:88526964-88526986 AAATTTCAGCACATTGTTTTTGG + Intergenic
910848417 1:91626692-91626714 CCATATAAAAACATTTTTATGGG - Intergenic
910954375 1:92685871-92685893 CAATTTCAGAACCTGTTAATTGG - Intronic
911119743 1:94283857-94283879 CCATTTCCAAACATCTTTATCGG + Intergenic
911243084 1:95486546-95486568 CAATTTCAGAACTTGTTATTGGG - Intergenic
911758522 1:101589017-101589039 CAATTTCATAGCATTTTTATGGG + Intergenic
913025849 1:114839246-114839268 AAATTTTAAAACTTTTTTATTGG + Intergenic
913105566 1:115610860-115610882 CAATTTTAGTTCATTTTTAAAGG + Intergenic
913175854 1:116272698-116272720 CAATATCTGTACATATTTATGGG + Intergenic
913659972 1:120998131-120998153 GAATTTGAAAAAATTTTTATAGG - Intergenic
913995186 1:143646018-143646040 CAATTTCAGAGAAGTGTTATAGG - Intergenic
914699924 1:150122696-150122718 CAATTTTAGAACATTTTCATTGG + Intronic
914737626 1:150433140-150433162 AAATTTAAAAAAATTTTTATGGG - Intronic
916448505 1:164896043-164896065 CAATTTCTCAATATTATTATAGG + Intronic
916549933 1:165840226-165840248 CTATTTAAAAACATTTTTAAAGG - Intronic
917321774 1:173789760-173789782 CAATCTCAGAAGATTTTCTTGGG - Intergenic
918949430 1:191116756-191116778 TAATTTGAAAACATTTTTATAGG + Intergenic
919100537 1:193092160-193092182 ACTTTTCAGAAAATTTTTATGGG - Intergenic
919197308 1:194302832-194302854 CAGTGTTAGAACATTTTAATTGG - Intergenic
919428271 1:197461135-197461157 TAATTTGAGAGCATTTATATTGG - Intronic
920165761 1:204034752-204034774 CTGTTTAAGGACATTTTTATGGG - Intergenic
921122228 1:212147160-212147182 CAAAATTAAAACATTTTTATTGG - Intergenic
921303872 1:213776228-213776250 CCTTTCCAGAACATTTTTAATGG + Intergenic
921871226 1:220142197-220142219 CCATTTCAGAACAGTTATAAAGG - Intronic
922463049 1:225827689-225827711 CAACTGTAGAACATTTTCATCGG - Intronic
923166165 1:231364668-231364690 CAATTTGAGACCTTTTCTATGGG - Exonic
923450292 1:234111029-234111051 AGATTTTAGAACATTGTTATAGG + Intronic
924204943 1:241702757-241702779 AAATTTCATATCAATTTTATGGG - Intronic
1063302280 10:4861318-4861340 CAAATATAGAACATTTTTTTGGG + Intergenic
1063837013 10:10026915-10026937 CAATTTCAGAATATTTATTCTGG + Intergenic
1065153784 10:22849323-22849345 CATTTGCAGAACATTTGGATTGG - Intergenic
1065695970 10:28379964-28379986 CAATAAAAGAACATTTTTTTAGG - Intergenic
1066028324 10:31389071-31389093 TAATTTCAGATCAGTTTTGTAGG + Intronic
1066534166 10:36372348-36372370 CATTTTCAGAACACTTTTTCTGG - Intergenic
1066691183 10:38030293-38030315 AAATTTCATAGCAGTTTTATGGG + Intronic
1067455998 10:46419651-46419673 CATTTTTAAAACATTTTAATAGG + Intergenic
1067631202 10:47964988-47965010 CATTTTTAAAACATTTTAATAGG - Intergenic
1067839780 10:49666381-49666403 CTATTAGAGCACATTTTTATGGG + Intergenic
1067915964 10:50399066-50399088 CAGTTTTAGAACATTTCCATCGG - Intronic
1067962490 10:50871465-50871487 AAATTTCAGAATAATTTCATTGG - Intronic
1067979789 10:51073050-51073072 CAATTTTATAGCATCTTTATTGG - Intronic
1068102815 10:52577550-52577572 CAACTGCAGAGCATTTTTGTTGG - Intergenic
1068307979 10:55239606-55239628 ACATTCCAGAACATTTTTCTGGG + Intronic
1068703591 10:60047660-60047682 CAATTTTTCAACATTTTTACTGG - Intronic
1069201640 10:65625220-65625242 AAATTACAGACCATGTTTATTGG + Intergenic
1070997889 10:80802271-80802293 CAATTTCAGTAGATATTTAGTGG - Intergenic
1071116755 10:82230581-82230603 CATTGTCAGAATATTTTTAAAGG - Intronic
1071703999 10:87976930-87976952 CATTTTCAGAAAATTTTAACAGG + Intergenic
1071889037 10:89982321-89982343 CAATTTAAAAAGATTTTTCTGGG - Intergenic
1072262953 10:93699274-93699296 CAGGTTCTGAACATTTTTATAGG - Intronic
1073769779 10:106723510-106723532 AAATTTTTGAACATATTTATTGG - Intronic
1074423289 10:113328255-113328277 AATTTTCAAAGCATTTTTATAGG + Intergenic
1076040131 10:127240040-127240062 TAATTGCAGAAGATGTTTATTGG - Intronic
1076584811 10:131538908-131538930 CACATTCAGTACATTTTTATGGG - Intergenic
1077713960 11:4562797-4562819 CAATTTCAGAACTTGTTAATTGG - Intergenic
1079417351 11:20251840-20251862 CATTTTCAGAATATGTTCATAGG - Intergenic
1080448449 11:32358734-32358756 CACTATCAGCACATTTTTGTGGG - Intergenic
1080985862 11:37464494-37464516 CAATTCTAGAAAATTTTTTTTGG + Intergenic
1081095735 11:38932196-38932218 CAATTTCAGATTTTTTTTTTTGG + Intergenic
1081624559 11:44642338-44642360 CAATTTTAGAACATTTTTAATGG + Intergenic
1083076692 11:60047395-60047417 AAATATTAGAACATATTTATTGG - Exonic
1083317137 11:61822908-61822930 CTATTTCTGAACATTTTCTTAGG + Intronic
1084983395 11:72845806-72845828 CAGCTTCAGTATATTTTTATGGG + Intronic
1085378898 11:76094526-76094548 CAATTTCAGAGCCTGTTAATTGG + Intronic
1086073696 11:82827067-82827089 TACTTATAGAACATTTTTATGGG + Intronic
1087428663 11:98022329-98022351 AGATTTCAAAACATTTGTATGGG + Intergenic
1087491693 11:98835971-98835993 AAATGCAAGAACATTTTTATAGG - Intergenic
1087979689 11:104596112-104596134 CAATTTTATAATATTTTAATTGG - Intergenic
1088113134 11:106284864-106284886 CATTTTCATAACTATTTTATAGG + Intergenic
1088392077 11:109325459-109325481 CAATTTCAGTACCATTTAATTGG + Intergenic
1088472446 11:110200821-110200843 AAATTTAAGAACATTTTAAAGGG + Intronic
1088713468 11:112528419-112528441 CTATTTCAGATCCTTTTAATAGG - Intergenic
1092943818 12:13434954-13434976 CCATTTAAGGACATTTATATAGG - Intergenic
1093656340 12:21698829-21698851 CAATTTCAGACTATTTTTCCCGG - Intronic
1094289317 12:28828733-28828755 CAAATTCACAACACTTTTTTTGG - Intergenic
1095135447 12:38595736-38595758 CTATTTCAAAACGTTTTTAGTGG + Intergenic
1095144832 12:38713703-38713725 TAATTTTAAAATATTTTTATAGG - Intronic
1095539787 12:43296121-43296143 CATTTTCAGAATATTTTTCAAGG + Intergenic
1095728251 12:45475343-45475365 GAATTTCATAACATTTTCAGAGG + Intergenic
1096041162 12:48518784-48518806 CCATTTCAAAAAATTTTTGTAGG + Intronic
1096741532 12:53697150-53697172 CAATCTCCCAACATTTTAATGGG - Intergenic
1096821214 12:54236452-54236474 CTAATTCAGAACATGTTTTTGGG + Exonic
1098856522 12:75658775-75658797 CAATTACAGAAAATTTATATGGG - Intergenic
1099067115 12:77995428-77995450 CTCTTTCAAAACATTTTTATAGG - Intronic
1099067414 12:78000395-78000417 TAATTTATGAACATTGTTATTGG - Intronic
1099405422 12:82254486-82254508 CAATTTATGTATATTTTTATTGG + Intronic
1099944418 12:89227556-89227578 CAATTTTTAAAAATTTTTATGGG - Intergenic
1100877400 12:98976286-98976308 CAATTTCAGTAAATATTTCTGGG - Intronic
1100944070 12:99759457-99759479 CAATTTCAGCAATTTTTTCTGGG + Intronic
1101069526 12:101059529-101059551 CAATTTCAGAACTTGTTATTGGG + Intronic
1102281012 12:111618951-111618973 TAATTTTAGAACATTTTTGCCGG + Intergenic
1102792770 12:115661172-115661194 CAATTCCAGGGCATATTTATAGG - Intergenic
1103282373 12:119770489-119770511 CATTTTCAATACATTTTTAAAGG - Intronic
1103827053 12:123747403-123747425 CAATTACAAAACAATTTTATCGG - Intronic
1105384612 13:19918142-19918164 AAATTTTAAAACCTTTTTATTGG + Intergenic
1107158591 13:37198493-37198515 CAATTTCAGCACATACTTCTGGG + Intergenic
1107319985 13:39176516-39176538 CAATTTCAAGGCAATTTTATAGG + Intergenic
1107392141 13:39976963-39976985 CCTTCTCAGATCATTTTTATTGG - Intergenic
1107691652 13:42959458-42959480 CAGTTTAAGAACAATTTTAGGGG - Intronic
1109089287 13:58018716-58018738 CAATTTCTTAACATTTTCAATGG - Intergenic
1109488420 13:63059449-63059471 TTATTTGACAACATTTTTATTGG - Intergenic
1110532710 13:76615495-76615517 CAATTTCAGAGCCTGTTAATTGG + Intergenic
1110832441 13:80046699-80046721 CAATGTCATAACATTTGTAAAGG - Intergenic
1110865311 13:80387829-80387851 GGATTTCAGAATACTTTTATAGG - Intergenic
1110961314 13:81629734-81629756 CATTTTCAGAACTTGTTTTTGGG + Intergenic
1110964359 13:81674244-81674266 CTGTTTAAGAATATTTTTATGGG + Intergenic
1111122263 13:83868607-83868629 AAATTCCCAAACATTTTTATTGG - Intergenic
1111508421 13:89227330-89227352 TCATTTCAGAACTTTTTTTTAGG - Intergenic
1111711599 13:91821812-91821834 CAATTTATTAATATTTTTATAGG + Intronic
1112114970 13:96341992-96342014 CAATTTCAGGACATTCATCTGGG - Intronic
1112510385 13:100003679-100003701 AAATATCAGAAAATTTTTATTGG + Intergenic
1112599974 13:100845614-100845636 CTTATTCAGTACATTTTTATTGG - Intergenic
1112927177 13:104690553-104690575 AAATTTAAGATCATTATTATGGG + Intergenic
1113170063 13:107491208-107491230 CAGGTTCAGAACATTTATAAAGG + Intronic
1113467543 13:110522906-110522928 CAATTGCAGAATATTTAGATTGG - Intergenic
1114033893 14:18602566-18602588 CAATTTATCAACATTTTTGTAGG + Intergenic
1114078688 14:19181740-19181762 CAATTTATCAACATTTTTGTAGG + Intergenic
1114124751 14:19712445-19712467 CAATTTATCAACATTTTTGTAGG - Intergenic
1114284312 14:21225828-21225850 TAATTTGAGAACAATTTCATGGG + Intronic
1114340625 14:21739182-21739204 CAATACAAGAACATTTTTTTGGG + Intergenic
1114738139 14:25064101-25064123 TTATTTCAGAACATTTGTTTTGG - Intergenic
1115245910 14:31294706-31294728 CAACCTCCTAACATTTTTATGGG + Intronic
1115823065 14:37233457-37233479 CAAGTTCAGGACACTTTTGTTGG + Intronic
1116155886 14:41205259-41205281 CAGCTACAGAAAATTTTTATAGG + Intergenic
1116223866 14:42122774-42122796 AATTTTCAGAATGTTTTTATGGG - Intergenic
1116557264 14:46326611-46326633 CAATTTCAACGCATTTTTAAGGG + Intergenic
1117084392 14:52184362-52184384 CAATTTGGGCACATTTGTATGGG - Intergenic
1117621569 14:57592602-57592624 CATTTTCAGAAAGTTTTAATTGG - Intronic
1117637866 14:57765471-57765493 CAATTTTCAAACATTTTTATTGG - Intronic
1117928911 14:60817204-60817226 AAATTAAAGAACATTTTTAATGG - Intronic
1118050747 14:62024508-62024530 CACTTTCCGATCAATTTTATTGG - Intronic
1118559187 14:67059927-67059949 TGATTTCAGAACAATTTTAATGG + Intronic
1119013517 14:71022629-71022651 TACCTTCTGAACATTTTTATGGG + Intronic
1120356935 14:83446011-83446033 TAATTTCAGCAAATTTTGATGGG + Intergenic
1120380904 14:83778305-83778327 CAATTTCAAAAAATTCCTATAGG + Intergenic
1120431396 14:84420373-84420395 AAATGTGGGAACATTTTTATAGG + Intergenic
1120614237 14:86682793-86682815 AATATTCAGAACATTTTTTTTGG + Intergenic
1120983780 14:90314829-90314851 CAAATTCAGAACCTTTTTGCCGG + Intronic
1121493055 14:94373556-94373578 CAATCTCAGAACATATTTTGAGG + Intergenic
1121847503 14:97186231-97186253 TAATTTCAGCACATTTGTTTGGG - Intergenic
1123568213 15:21573735-21573757 CAATTTATCAACATTTTTGTGGG - Intergenic
1123604321 15:22009057-22009079 CAATTTATCAACATTTTTGTGGG - Intergenic
1123958357 15:25365134-25365156 TAATTTCTGAACTTTTTAATTGG + Intronic
1125086128 15:35732167-35732189 CAATAACAGAACATTTCTAAAGG + Intergenic
1125121712 15:36167577-36167599 CAATTTAAGAACATTTCCTTTGG + Intergenic
1125379981 15:39077293-39077315 CAATTTCACAATACTTTTATAGG + Intergenic
1126304129 15:47235482-47235504 CATTTTCAGTTGATTTTTATAGG + Intronic
1126733690 15:51710515-51710537 AAATTCCATACCATTTTTATAGG + Intronic
1127830875 15:62749951-62749973 CAATTTTGGAACATTTTAATAGG - Intronic
1128015341 15:64340052-64340074 AAATTTCCAAACATTTTTAAAGG + Intronic
1128127898 15:65206418-65206440 GAATTTCAGAAAATTTGTCTAGG + Intronic
1128441962 15:67718459-67718481 CATTTTTAAAAAATTTTTATGGG + Intronic
1129550007 15:76438297-76438319 AAATTTAAGAATATATTTATGGG + Intronic
1129953280 15:79610775-79610797 CAGTTTCAGAAGATTTTATTTGG + Intergenic
1130058294 15:80549135-80549157 CAATTTAAGAAAATGTTGATGGG + Intronic
1130844038 15:87727354-87727376 GAAGTTCAGAACACTTTTAATGG + Intergenic
1131726890 15:95235963-95235985 AAATTACATATCATTTTTATTGG + Intergenic
1202976570 15_KI270727v1_random:300823-300845 CAATTTATCAACATTTTTGTGGG - Intergenic
1133400894 16:5486143-5486165 GAATTGAAGAGCATTTTTATAGG - Intergenic
1133682642 16:8134519-8134541 CATCTTGATAACATTTTTATAGG + Intergenic
1133708678 16:8380097-8380119 CCTTTTCTGAACATTTTTAAGGG - Intergenic
1133904605 16:10010525-10010547 TAATTTTACAACATTTTTACAGG - Intronic
1134624862 16:15716250-15716272 CATTTTGAGAACATTTTCATCGG - Intronic
1134845653 16:17437715-17437737 CAATTACAGAAAATTGTTCTGGG + Intronic
1134907704 16:17995102-17995124 TCATTTCAGACCATTTTTAGAGG - Intergenic
1135183606 16:20295907-20295929 CAATTTAAGAACACTTGTATCGG + Intergenic
1137476438 16:48813541-48813563 GAATTTCAGAACTTTGTTTTAGG + Intergenic
1137740800 16:50771114-50771136 CAGTTCCAGAACATTTTCATGGG + Intronic
1138703403 16:58888933-58888955 AAATTTGAGAACATTTCTCTAGG - Intergenic
1138711064 16:58971071-58971093 CAATCTCAGAACTTTTCTAAAGG - Intergenic
1138728350 16:59165734-59165756 CATTTGCATAACACTTTTATTGG - Intergenic
1138830623 16:60370161-60370183 CATGTTCAGAACATTTACATTGG + Intergenic
1139159602 16:64488503-64488525 CTATTACAGAACCCTTTTATTGG - Intergenic
1139344617 16:66294519-66294541 CATTTACAGAACCTATTTATGGG + Intergenic
1139799347 16:69508917-69508939 CTATTTAAAAACATTTTTTTTGG + Intergenic
1144996909 17:19276069-19276091 CAATTTCAAAACAGGTTTTTAGG + Intronic
1145048862 17:19643526-19643548 AAATTTCATTACATTTTCATTGG - Intergenic
1146188284 17:30741193-30741215 AAATTTCAGAAAATTTTCTTGGG - Intergenic
1146333156 17:31945509-31945531 AAATTTCAGAAAATTTTCTTGGG - Intronic
1146521917 17:33532008-33532030 CACTTTCAGGTCTTTTTTATTGG + Intronic
1148788100 17:50155823-50155845 CAATTAATGAACATTTTTGTAGG - Intergenic
1149016248 17:51911870-51911892 CAATTTCAGTGCATATTAATTGG + Intronic
1149111479 17:53036463-53036485 AATTTCCAGAACAGTTTTATAGG + Intergenic
1149840166 17:59956173-59956195 CAATTTCATAAGATTGTTAAGGG + Intronic
1150978365 17:70114147-70114169 AAAATTCAGGACATCTTTATTGG - Intronic
1155389640 18:25320831-25320853 CAGTTCCAGAAAATGTTTATGGG + Intronic
1155568855 18:27167865-27167887 CTGTTTCAGAGCATTTTGATAGG - Intronic
1155603811 18:27580696-27580718 CAATTTCAGATTATTATTATTGG + Intergenic
1155685515 18:28543825-28543847 TAATTTCAGATCATTTTACTGGG + Intergenic
1156705470 18:39876248-39876270 CAATTTCAGGGTATTTTTTTAGG - Intergenic
1156946013 18:42832552-42832574 CAATTTTTGTACATATTTATGGG + Intronic
1157008949 18:43623016-43623038 CAAGTTCACAACATATTTAATGG + Intergenic
1157129139 18:44987166-44987188 CAGTTTCACTACAATTTTATGGG + Intronic
1157467717 18:47961815-47961837 CAATTTTAGAACATTTCCATAGG + Intergenic
1157674048 18:49555194-49555216 CAATCACAGTATATTTTTATTGG - Intergenic
1158170296 18:54590926-54590948 CTATCTCAGAACGTTTTTCTGGG + Intronic
1158177673 18:54675937-54675959 CAAATTAATAAGATTTTTATAGG + Intergenic
1158538629 18:58331450-58331472 CAATTTCACAACATTTCTCAAGG - Intronic
1158659021 18:59368644-59368666 CAATTTCAGAACTTATTATTGGG + Intergenic
1158741556 18:60148323-60148345 ATATTTCAGAACCTCTTTATTGG + Intergenic
1159797778 18:72865810-72865832 GAGGTTCAGAACATTTTTGTAGG - Intronic
1161361723 19:3853722-3853744 AAATTCCAGAACATTCCTATCGG - Intronic
1164074987 19:21807128-21807150 CAACATCAGAAAATTTATATTGG - Intronic
1164667246 19:30049277-30049299 CAATTTTAAAGAATTTTTATAGG - Intergenic
1165667092 19:37641274-37641296 AAATATTAGAACATGTTTATAGG - Intronic
925053184 2:833282-833304 CAAGTACAGAACACTTTTACAGG + Intergenic
927290623 2:21401491-21401513 CATTTTCAGAACACTTGCATTGG - Intergenic
927293707 2:21429207-21429229 CAAATTCTGAACAATCTTATTGG + Intergenic
927723245 2:25400975-25400997 TAATTTCTGAACACTTTTCTTGG - Intronic
928761580 2:34589505-34589527 CAATTTCACTACATGTTTACTGG + Intergenic
929346636 2:40891437-40891459 AGATTTCATAACTTTTTTATTGG - Intergenic
929674522 2:43912293-43912315 CCATTTCATATGATTTTTATGGG + Intronic
930268686 2:49230375-49230397 CAATTTCAGAGCCTGGTTATTGG + Intergenic
930410601 2:51021297-51021319 AATTTTCAGTACATATTTATAGG + Intronic
930485391 2:52006265-52006287 TAATATGAAAACATTTTTATTGG + Intergenic
930858802 2:56047905-56047927 CACTTTAATACCATTTTTATAGG - Intergenic
931220702 2:60285838-60285860 CCACTTCAGAAGCTTTTTATGGG + Intergenic
931529214 2:63194098-63194120 TAATATCAAAACATTTTTAAAGG - Intronic
931570762 2:63667151-63667173 CATTTTCATAACAGTTTTCTTGG - Intronic
932017130 2:68041302-68041324 CAATTGCAGAAAATCATTATTGG - Exonic
932363093 2:71126148-71126170 CTATTTCAAAACATTTTCACTGG - Intronic
933056293 2:77671505-77671527 CAATTACAGAACAATTTCCTGGG + Intergenic
933927847 2:87115820-87115842 CAATTACAGAACAATTTCCTGGG + Intergenic
934021472 2:87958516-87958538 TAATTACATAACATTTTAATAGG - Intergenic
934999294 2:98996694-98996716 TAATTACAGAACATTTATATGGG - Intergenic
935505106 2:103890777-103890799 CAATTTCAGATCTCTTTGATTGG + Intergenic
936804000 2:116303562-116303584 TAAGTTCAGAACACTTTTAAGGG - Intergenic
936881188 2:117252896-117252918 AAATTTCAGAACATTTAATTTGG - Intergenic
939489779 2:142863257-142863279 TAATTTCAGAATATTTTGAAGGG + Intergenic
939687655 2:145219396-145219418 TAATTTCAGGATATTTTCATTGG + Intergenic
939709453 2:145498282-145498304 TAATTTCAAAACTTTTTTTTGGG + Intergenic
940548556 2:155121470-155121492 AAACTTCAAAACATTTTAATTGG + Intergenic
941197123 2:162466792-162466814 AAATTTAAGAACAATTTAATTGG + Intronic
942345769 2:175001348-175001370 TAATTTCAGGACATTCCTATGGG + Intronic
942379480 2:175373737-175373759 AAAATTCAGGACATTTTTACTGG + Intergenic
942495243 2:176533332-176533354 CATTTTTAGAACATTCTTAGTGG - Intergenic
942997391 2:182279636-182279658 CACTTTTAAAACATCTTTATTGG + Intronic
943438630 2:187898768-187898790 CAATTTAATAACAGTTTTGTAGG - Intergenic
943545883 2:189277296-189277318 CATGTTAAGAACATTTTGATTGG - Intergenic
943957879 2:194216295-194216317 AGATTTTAGAACATTTTTAGTGG + Intergenic
944230603 2:197388160-197388182 GAATTTCAAAACAGTTTTCTTGG - Intergenic
944399908 2:199313816-199313838 CAATTTAAGAACATTACTAGAGG + Intronic
944500982 2:200360162-200360184 CAAGTTCAGAACAATTTCACTGG + Intronic
944564479 2:200974016-200974038 GAATTTAAGATCATATTTATTGG - Exonic
944796727 2:203194051-203194073 GATTTTTAAAACATTTTTATTGG + Intronic
945588865 2:211702598-211702620 TAATTTCAGAAAATGATTATAGG + Intronic
946806242 2:223473807-223473829 CAATCTCATAACACTTTTTTGGG + Intergenic
946914019 2:224497016-224497038 CAAAATTAGAATATTTTTATGGG + Intronic
947023750 2:225713594-225713616 CAATTTCAGAGCCTGTTTATTGG - Intergenic
947329079 2:229009394-229009416 TTCTTTCAGAACATATTTATGGG + Intronic
947416477 2:229901665-229901687 CTACTTCAGAACAGTTTTTTAGG + Intronic
948049763 2:234971009-234971031 CAATTTTAGAATTTTTTTAAAGG - Intronic
1169622708 20:7525690-7525712 AAACAACAGAACATTTTTATAGG + Intergenic
1169759009 20:9070663-9070685 AAATGGCAAAACATTTTTATTGG + Intronic
1172227532 20:33315032-33315054 CCACTTCACAACGTTTTTATAGG - Intergenic
1172417835 20:34785999-34786021 CAATTTCAGAACTTGTTAATTGG + Intronic
1172835590 20:37871070-37871092 CAGTTTGAGAACCTTTTTTTGGG - Intronic
1173452106 20:43173863-43173885 GAATGTTAGAAGATTTTTATGGG - Intronic
1174874843 20:54216537-54216559 CATTTAAAAAACATTTTTATTGG + Intronic
1177286567 21:19059102-19059124 AAACTACAGGACATTTTTATAGG - Intergenic
1177375541 21:20266006-20266028 TAATTTTTGAACATTGTTATTGG + Intergenic
1179307340 21:40166879-40166901 CAATTTGAAAACATTTTTGCTGG + Intronic
1179345737 21:40555326-40555348 TACTATCAAAACATTTTTATAGG - Intronic
1180458011 22:15529608-15529630 CAATTTATCAACATTTTTGTAGG + Intergenic
1181485544 22:23229459-23229481 CATTTTCAGAACATTTAAACAGG - Intronic
1182349220 22:29689497-29689519 CAATTCCACTGCATTTTTATGGG + Intronic
1183569511 22:38642030-38642052 TAATTTTGGTACATTTTTATTGG - Intronic
949592916 3:5512300-5512322 CAATTTCAGAACTTGTCTATTGG - Intergenic
950671400 3:14528005-14528027 AAGTTTTAGAACATTTCTATTGG + Intronic
951246892 3:20351519-20351541 CAATTTTTAAACATTTTTGTGGG + Intergenic
951346908 3:21557830-21557852 CAATTTCAGAACTTGTTATTGGG + Intronic
951734306 3:25847650-25847672 GAATTTCATATCATTTTCATGGG - Intergenic
952265876 3:31785816-31785838 GAATTTCAGAAAATTATTAAGGG - Intronic
953721604 3:45360595-45360617 CAATTTCAGAACTCGTTAATTGG + Intergenic
955214591 3:56974508-56974530 AAATTACAGAACATTTTTGAAGG + Intronic
955862006 3:63340864-63340886 CAATATCAATACATTATTATTGG + Intronic
956156058 3:66298400-66298422 CACTTTCAGCATATTTTTAATGG + Intronic
956321616 3:68003791-68003813 AAAGTTCAGAAGGTTTTTATTGG + Intergenic
956430692 3:69183248-69183270 AAATTTCATATCATTTTTACAGG + Intronic
956916619 3:73878727-73878749 CAATATCAGAGAATTTTTATAGG - Intergenic
957183140 3:76907628-76907650 CAATTTGATAATATTTTTAGGGG + Intronic
957225721 3:77442819-77442841 CCATTTCAGAAACTTTATATGGG - Intronic
957595661 3:82262437-82262459 CATTTTCAGAACATTTATAAGGG + Intergenic
957970024 3:87371394-87371416 AAATATCAGAAAATTTTTAAAGG - Intergenic
958177917 3:90020593-90020615 CAATTTCAAGACATTTAAATTGG + Intergenic
958528935 3:95299317-95299339 CAATTTCTGCACAACTTTATTGG - Intergenic
958991856 3:100855292-100855314 CAGTATCAGGGCATTTTTATTGG - Intronic
959086786 3:101859054-101859076 CAACTTCAGATAATTTTTAGTGG + Intronic
959386538 3:105715595-105715617 CAATTTCACAATATTATCATTGG + Intronic
959437623 3:106336172-106336194 TAATTTCACAACACATTTATTGG - Intergenic
959802978 3:110517433-110517455 CTATCTCAGACCATTTTTAAGGG + Intergenic
959981164 3:112519141-112519163 CAAGTTCTGATGATTTTTATAGG + Intergenic
960150398 3:114243377-114243399 CTATTTCTGAACCTTTTTAGTGG - Intergenic
960240341 3:115333585-115333607 GAATTTCAGAAAATTTAAATAGG + Intergenic
960707802 3:120497232-120497254 CATTTTCTTAACATTTTTAGTGG + Intergenic
962517685 3:136169052-136169074 CAATGACAAAACATTTTTAATGG + Intronic
963339174 3:144013677-144013699 CATTTTCAGTACAATTTTAGGGG - Intronic
963358535 3:144240399-144240421 CAATTGCAGAGCATGTTTTTGGG + Intergenic
963880442 3:150522551-150522573 CAATTTCATTATAATTTTATAGG + Intergenic
964373711 3:156028769-156028791 CATTTTCAGAATATTTTTATTGG - Intergenic
964409962 3:156387481-156387503 TAATTTTAAAACATTTTTGTTGG + Intronic
964700197 3:159557215-159557237 CAATTTAAGAATCTTTTTTTTGG - Intronic
964989971 3:162798297-162798319 CAATTACTGAACATTTTTGAAGG - Intergenic
965200510 3:165651466-165651488 ACAATTCAGAACATTTTTAGTGG + Intergenic
965680255 3:171243282-171243304 CCCTTTCAGGAAATTTTTATTGG - Intronic
965773548 3:172206167-172206189 CAGTTTCAGATGATTTTTATAGG + Intronic
966213060 3:177472605-177472627 CAATTTCATAAGATTGTTGTAGG + Intergenic
966292570 3:178377344-178377366 CAATTTAAGAACATATTGAATGG + Intergenic
966432661 3:179848726-179848748 CAATTTGAGGGCATTTTGATTGG - Intronic
966602531 3:181789700-181789722 CAATTTAAAAAAATTTTTTTGGG + Intergenic
967132108 3:186480882-186480904 AAAATTGAAAACATTTTTATGGG - Intergenic
967208869 3:187149174-187149196 AAATGTCAGAATATTTTTAAAGG - Intronic
967859168 3:194138847-194138869 CAACTTAAAAACATTTTTTTTGG - Intergenic
968409451 4:375350-375372 CAACATCAGAAAATTTATATTGG + Intronic
969159544 4:5244243-5244265 CAATTTCAGAGCCTGTTTATTGG + Intronic
970176533 4:13345357-13345379 CAATTTTTGGACATTTTAATGGG - Intergenic
970292825 4:14594285-14594307 CAATTTAAAAATATTTTTCTTGG - Intergenic
970413540 4:15834475-15834497 CAATTTTAGAACATTCTTAGAGG + Intronic
970811884 4:20104087-20104109 AAATTACAGAACATGGTTATAGG - Intergenic
971477474 4:27085890-27085912 CAAATTCCAAACATTTTTAAAGG + Intergenic
971682091 4:29713393-29713415 CAATTTGAAATGATTTTTATAGG + Intergenic
972000547 4:34026846-34026868 CAATTTTAGATGATTTTTGTTGG - Intergenic
972079231 4:35128862-35128884 CAATATCAGGATATTTTTATTGG - Intergenic
972591584 4:40493149-40493171 CAATTTCAAGATATATTTATAGG + Intronic
973096726 4:46211583-46211605 CACTTTGAGAACATGTTTAGTGG + Intergenic
973483429 4:51016582-51016604 CAATTTTAAAACATTCTTTTTGG + Intergenic
973818705 4:54643152-54643174 CAATTTCAGAATGTTTTGGTTGG + Intergenic
974130215 4:57745410-57745432 CAATTTCAGAACTTGTTATTGGG + Intergenic
974788218 4:66650403-66650425 TACTTTCAGACCATTTTTACAGG + Intergenic
974816253 4:67007714-67007736 CAAATTCAGTACATATTTAATGG + Intergenic
975167255 4:71190676-71190698 CAATTTAATAGCAATTTTATGGG - Intronic
975446826 4:74475120-74475142 GAATTACAGAACATTTTAGTTGG - Intergenic
975920849 4:79385234-79385256 CAACTTCTGCACATTTTCATTGG - Intergenic
976215628 4:82712930-82712952 CAAAATCAGAACATTTTCAAGGG + Intronic
976249906 4:83039796-83039818 TAATTTAAAAACATTTTTTTTGG + Intronic
976380809 4:84396126-84396148 CAATTTCAAAACTTTTTTTCGGG + Intergenic
976483521 4:85572767-85572789 AAATTTAAAAACATTTTTAGGGG - Intronic
976528706 4:86124597-86124619 CCATTTCAGCACATTCTTGTGGG - Intronic
976968961 4:91080880-91080902 CAATTTCAGAACCTGTTATTGGG - Intronic
977951161 4:102971963-102971985 CAATTTCAGAGCCTGTTAATGGG - Intronic
978458180 4:108919166-108919188 TAATTACAGACCATTTTTTTAGG - Intronic
978651586 4:111011875-111011897 CAACTTCAGAATATTATTTTTGG + Intergenic
979003471 4:115258164-115258186 CATTTTTAAAATATTTTTATTGG - Intergenic
979106466 4:116695454-116695476 AAATTACAGAATATTTATATAGG - Intergenic
979132625 4:117067214-117067236 TAATGTCAAAACATTTTTACCGG + Intergenic
979386900 4:120077371-120077393 CAATTTAAGAAGAATTATATAGG + Intergenic
979535033 4:121809958-121809980 TCATTTCAGAACATATTTATTGG + Exonic
979900465 4:126209698-126209720 TAATTTCAGTACATTTGTATTGG + Intergenic
980076367 4:128298086-128298108 CAATGTCAAAATATTTTTTTAGG + Intergenic
980078063 4:128314791-128314813 TAAATTCAGGACATTTATATGGG + Intergenic
980593156 4:134917749-134917771 CTATTTGAGCACATTTTCATTGG + Intergenic
981233567 4:142388253-142388275 AAATTTAAGAGCATTTTTAAAGG + Intronic
981585937 4:146302354-146302376 CTCTTTCAGCACATATTTATTGG + Intronic
981974179 4:150703563-150703585 TAATTTCAAAACATTTTTAATGG + Intronic
982613040 4:157601672-157601694 AGTTTTCAGAACATATTTATAGG + Intergenic
983059390 4:163139390-163139412 CAATTTGAAAATATTTTTAGTGG + Intronic
983759409 4:171386179-171386201 CAACTTTACAACATTTCTATGGG - Intergenic
983824494 4:172241016-172241038 TTATTTCAGAACATTTTCAGAGG + Intronic
983837461 4:172408873-172408895 CAGTTTCTGAAGATTTCTATTGG - Intronic
987213078 5:15704347-15704369 CAATGGTAGAACTTTTTTATGGG + Intronic
987700937 5:21397380-21397402 CAAAATCAGAAAATTTATATTGG - Intergenic
988114749 5:26871380-26871402 GAATTTAAGAACATCTTTCTGGG - Intergenic
988150505 5:27372325-27372347 CCAATTCAGAACGTTTCTATTGG + Intergenic
988158199 5:27482335-27482357 AAATTTCAGATTATTTTCATTGG - Intergenic
988176823 5:27737694-27737716 CTATTTCAGAAGATTGTTATAGG - Intergenic
988965463 5:36412311-36412333 AAATTTTAAAAAATTTTTATGGG - Intergenic
988988175 5:36641760-36641782 AAAATTCATAACATTCTTATGGG + Intronic
989002814 5:36778535-36778557 CATTCTGACAACATTTTTATTGG - Intergenic
989226771 5:39037792-39037814 CAATTTCAGAAGCCTGTTATTGG - Intronic
989487778 5:42012023-42012045 CAAGGTGAGAACATTTATATAGG + Intergenic
989671902 5:43927862-43927884 AATTTTCAGAACAATCTTATGGG - Intergenic
989788869 5:45367547-45367569 CAATTTCAGAAAATCATTAATGG + Intronic
990640367 5:57776922-57776944 TAAATTGAGAACATTTTCATGGG - Intergenic
990669268 5:58109193-58109215 CAATTTCAGAACATTAATGGAGG - Intergenic
991611626 5:68455565-68455587 CAAAGTCATATCATTTTTATGGG - Intergenic
991632076 5:68666296-68666318 GAATTTCATATCATTTTCATGGG + Intergenic
991709396 5:69393133-69393155 TAATTCCAGAAATTTTTTATAGG + Exonic
992560502 5:77948031-77948053 CACTTTCAGATCCTTTGTATGGG - Intergenic
992796958 5:80261905-80261927 TAATTTAAGAAAATTTTTGTGGG - Intergenic
993041160 5:82816425-82816447 CAATTACAAAACACTTTTTTCGG + Intergenic
993099819 5:83524056-83524078 TAAATGCAGAACATTTTTACTGG - Intronic
993152846 5:84182659-84182681 GAATTTCATAACATTTTAAATGG - Intronic
993301487 5:86216353-86216375 AAATTACAGAATATTTTTAAAGG - Intergenic
993430629 5:87828435-87828457 CAATCTCAGATCATTGTTGTTGG + Intergenic
993518642 5:88870162-88870184 AAATTTGAGTAAATTTTTATAGG - Intronic
993546907 5:89223404-89223426 CAATTTCAGAGCCTTGTTATTGG - Intergenic
993760346 5:91787786-91787808 CTGATTCAGAACAGTTTTATAGG + Intergenic
994382116 5:99083770-99083792 GAATTTCAGAGCAGTTTCATTGG - Intergenic
994677211 5:102839001-102839023 AAATTTCATTACTTTTTTATTGG + Intronic
994746441 5:103684321-103684343 CCATTTCATTACACTTTTATAGG - Intergenic
995909930 5:117174809-117174831 TAATTTCAAAACAGTTTTAGAGG + Intergenic
995928967 5:117412170-117412192 CAATTAGGTAACATTTTTATGGG + Intergenic
996351312 5:122545051-122545073 CAACATCAGAACTTTTTAATGGG - Intergenic
996605350 5:125314440-125314462 CATTTTCAGGTTATTTTTATAGG + Intergenic
996828018 5:127707546-127707568 CAATTTCTGGACATTTCTAAGGG - Intergenic
997494698 5:134312567-134312589 CACTTGCAAAACATTATTATAGG + Intronic
997708001 5:135976832-135976854 CTCCTTCAGAACATTTTTCTAGG + Intergenic
998680115 5:144457693-144457715 CAATATCACAACATATATATTGG - Intronic
998719286 5:144925752-144925774 CAATCTCATAACATTTGAATAGG + Intergenic
998977684 5:147666224-147666246 AATTTTCAGAAAATTTTTATTGG - Intronic
999173521 5:149615589-149615611 GATTTTAAGAACATTTTTTTTGG + Intronic
999211604 5:149894338-149894360 AAATTTCAGAAAATTTCTCTGGG + Intronic
1000132724 5:158315470-158315492 CAATTAGAGAACATTGTAATGGG + Intergenic
1000583538 5:163065009-163065031 AAATTTAAGAACATTTATTTGGG - Intergenic
1001010342 5:168092069-168092091 CATTTTAAGAACTTTTCTATTGG + Intronic
1002156111 5:177281373-177281395 CATTTTCTGAAGAATTTTATTGG + Intronic
1002158309 5:177300139-177300161 GAATTACAGTACATGTTTATGGG - Exonic
1002363370 5:178691531-178691553 CAATTTACCAACATTTTAATGGG - Intergenic
1003792279 6:9559514-9559536 TACTTGCAGAACATTTTTTTTGG - Intergenic
1004420547 6:15465739-15465761 GAATCTTAGAATATTTTTATTGG + Intronic
1005282878 6:24293327-24293349 CAAGTTCAGTAAATTTTTATGGG + Intronic
1005298118 6:24446328-24446350 TAATTTAAAAACATTTTTATAGG - Intronic
1007451814 6:41945794-41945816 AATTTTCAGAACATCATTATAGG - Intronic
1008884704 6:56419668-56419690 CAATTTCAAAATTCTTTTATAGG + Intergenic
1009205957 6:60801852-60801874 CAATTACAAACCATTTTTAAAGG - Intergenic
1009518232 6:64647627-64647649 CATTATCAGAATATTTTTAAAGG - Intronic
1009542817 6:64985223-64985245 CAAAGTCATAACATTTGTATAGG - Intronic
1010090832 6:71979608-71979630 CAATTTGAGAATAATTTTTTTGG + Intronic
1010292719 6:74157051-74157073 GAATTTCTGAATATTTTTAAAGG + Intergenic
1010507205 6:76675259-76675281 CAATTTAAAAACTTTTTTGTAGG + Intergenic
1010753468 6:79640521-79640543 CAATTTGGGAACAATTTTGTTGG + Intronic
1011329608 6:86188989-86189011 CAATCTCATAAGACTTTTATTGG - Intergenic
1011390775 6:86850453-86850475 CAACTTCAGAATATCTTTCTAGG + Intergenic
1011677133 6:89745496-89745518 CAATTTTAGAACATTTTCTTTGG + Exonic
1011878092 6:91987497-91987519 AAATCTAAGAACATATTTATAGG - Intergenic
1011930676 6:92708087-92708109 CATGTGGAGAACATTTTTATTGG - Intergenic
1012081823 6:94768671-94768693 CAAATACAGAAGATTTATATAGG - Intergenic
1012251239 6:96983548-96983570 CAATTTCAGAGCCTGTTAATTGG + Intronic
1012811732 6:103967359-103967381 CAATTTCAAACCATTTATTTGGG + Intergenic
1012814843 6:104010354-104010376 CAATATCAGAACATTTTTGCTGG + Intergenic
1012961488 6:105626818-105626840 CTATTTCAGAAGACTTTTTTAGG + Intergenic
1013205415 6:107940548-107940570 GAATTTCTGAAGATTTTTTTTGG - Intronic
1013718839 6:112998555-112998577 AAATATCAAAACATTTTTATTGG - Intergenic
1013832326 6:114288996-114289018 CATTTTCAACACATTCTTATTGG + Intronic
1013845779 6:114449677-114449699 TAAGTTCAGAACACTTTTTTAGG + Intergenic
1015213788 6:130726824-130726846 CTGTTTAAGAACATTTTTGTAGG - Intergenic
1015449015 6:133342396-133342418 GAATTTCAGGACAATTTTCTGGG + Intronic
1016594183 6:145780935-145780957 CACTTGCAGTACATTTTTAAAGG + Intergenic
1017194215 6:151682883-151682905 CTATTTCATAAAATTTTTGTAGG - Intronic
1018010945 6:159669295-159669317 CATTTACAGAACATTCTAATAGG - Exonic
1019233814 6:170591714-170591736 CATTGTCAAAACATTTTTATTGG - Intergenic
1019684049 7:2370650-2370672 TCATTTCAGAACGTTTTCATCGG + Intronic
1020434559 7:8148676-8148698 CAATTTCAGGACATTTTCAAGGG + Intronic
1020803050 7:12755905-12755927 CATTTTCAGAAAATATGTATAGG + Intergenic
1021359548 7:19693784-19693806 CAGTTGCAGAAGATTCTTATAGG - Intergenic
1022179099 7:27900746-27900768 CATTTACAGAACATTTTTTATGG + Intronic
1022226192 7:28365850-28365872 AAATTTTACAAAATTTTTATAGG - Intronic
1022343855 7:29494585-29494607 AAATTTCTCAACATTTTTCTAGG - Intronic
1023051417 7:36255474-36255496 CAATTTCAGAACTTGTTATTGGG + Intronic
1023228771 7:38001809-38001831 CCATCTGAGAACATTTCTATAGG + Intronic
1023579493 7:41666187-41666209 AAATTTAAACACATTTTTATAGG + Intergenic
1025721373 7:64018607-64018629 CATTTTTAAAAAATTTTTATGGG + Intergenic
1025871474 7:65438391-65438413 AGATAGCAGAACATTTTTATGGG - Intergenic
1025939486 7:66064117-66064139 TAATTTAAAAACATTTTCATTGG - Intergenic
1026046194 7:66906860-66906882 TAATTTCAGAAGATGTGTATGGG - Intergenic
1027303445 7:76866829-76866851 CAATTTTAGTACTGTTTTATGGG + Intergenic
1027580580 7:79989888-79989910 CATTTTCAGTAAATTTTTAAAGG - Intergenic
1027632676 7:80626518-80626540 AATTTGCAGACCATTTTTATTGG - Intronic
1027812636 7:82924510-82924532 CAATTTTTCAAGATTTTTATAGG - Intronic
1028736990 7:94225623-94225645 CAATTTCAGAAAGATTATATAGG + Intergenic
1028943816 7:96554864-96554886 CAATTTCAGCTCCTGTTTATTGG + Intronic
1030142282 7:106317551-106317573 TGTCTTCAGAACATTTTTATGGG - Intergenic
1030335473 7:108321058-108321080 CAAGTTCAGAAAAGTTGTATAGG + Intronic
1030339646 7:108362578-108362600 CAATTTCAGTATATATGTATAGG - Intronic
1030428495 7:109411225-109411247 TTATTTCAAAACATTTTGATTGG + Intergenic
1031021170 7:116629545-116629567 TATTTTCACAACATTTTTATTGG + Intergenic
1031273075 7:119679160-119679182 CAAATTCAGCACATTTTTGTTGG - Intergenic
1031466011 7:122112729-122112751 GAAATATAGAACATTTTTATTGG - Intronic
1033415864 7:141160830-141160852 TAAATTCAACACATTTTTATTGG + Intronic
1033588760 7:142793341-142793363 CCAGACCAGAACATTTTTATTGG - Intergenic
1034083030 7:148298290-148298312 CAATTTCATGACATGTTTTTAGG - Intronic
1034163414 7:149008387-149008409 CATTTTCAGAACATTTGCTTTGG - Intronic
1034408457 7:150922380-150922402 CAATTTGGCAACATTTTTATAGG + Intergenic
1036118278 8:5985527-5985549 TAATTCCAGAACAGTTTCATTGG - Intergenic
1037191647 8:16133192-16133214 CAAGTTCAAGACACTTTTATAGG + Intronic
1037338660 8:17817326-17817348 CATTATCAAAACATTTTCATTGG + Intergenic
1037465422 8:19155173-19155195 AAATTTTAAAACATCTTTATTGG - Intergenic
1038633451 8:29266758-29266780 TATTTTCAGAACATTTTAAATGG - Intergenic
1040835452 8:51725711-51725733 CAACTAAAGAACATTTTGATTGG + Intronic
1041073367 8:54146806-54146828 CACTTTCAGAACATGTGTCTCGG + Intronic
1041132215 8:54713145-54713167 AAATTTGGAAACATTTTTATAGG + Intergenic
1041665561 8:60441296-60441318 CAATTTCAGAGCCCTGTTATTGG + Intergenic
1041948208 8:63470709-63470731 CCATTTCTGAACTGTTTTATAGG - Intergenic
1042012922 8:64269287-64269309 CAATTTCAGAGTATATTTAGGGG + Intergenic
1042433426 8:68735333-68735355 AAATTTCAGAACAGTTTGAATGG - Intronic
1042811617 8:72831739-72831761 CAATTTCATATCTTTGTTATGGG - Intronic
1043151448 8:76721751-76721773 CAATGTGACAACATCTTTATTGG - Intronic
1043208894 8:77485110-77485132 CAATTTAATAACAATTTCATAGG - Intergenic
1043840801 8:85101618-85101640 ATATTTCAGAACATTTGTCTAGG - Intergenic
1044369614 8:91393501-91393523 CAATTTTATATCATTCTTATAGG + Intronic
1045159991 8:99528875-99528897 CCTTTTCAGTACATTTTAATTGG + Intronic
1045989480 8:108288536-108288558 CAATTTACGAACATTTTTCAGGG + Intronic
1046136227 8:110031059-110031081 CACTTTCAGTAAATTTTTATAGG - Intergenic
1046314522 8:112481272-112481294 AAATTTCAAAACATTTATGTGGG + Intronic
1047399929 8:124537804-124537826 CAATTTCAAAACCTTTTTCCTGG + Intronic
1048592043 8:135829404-135829426 CAATCTCGGCACATTTATATGGG + Intergenic
1048693648 8:136997879-136997901 CAAGTTCAGCATATTTTTGTGGG + Intergenic
1049907034 9:227643-227665 AAAATACAGAACATTTCTATTGG + Intronic
1050210261 9:3246089-3246111 CAAATTCAGACTAATTTTATAGG - Intronic
1050582597 9:7076232-7076254 TAATTTCAAACCATTTTTACTGG + Intronic
1050627743 9:7523473-7523495 GAATTTCAGATCATTTCTATTGG - Intergenic
1050628409 9:7533106-7533128 CAATATCAAATCATTTTTATTGG - Intergenic
1050629718 9:7545593-7545615 TATATTCAGAACATTTTTCTGGG + Intergenic
1050758790 9:9040454-9040476 CAAATTCTGCACATTTATATTGG + Intronic
1050802133 9:9628774-9628796 AAATTTCTATACATTTTTATAGG + Intronic
1051407182 9:16750298-16750320 TAATTTCAGAAAATATTTTTAGG - Intronic
1051870954 9:21736943-21736965 CAACTTCAGGATATTTTTTTTGG - Intergenic
1051993504 9:23183405-23183427 CAATTTGAAAATATTTTAATAGG - Intergenic
1052200060 9:25767345-25767367 CAATTTCAGAACTTGTTATTGGG - Intergenic
1052665716 9:31492856-31492878 CACTTTCAAAACATTCTTAAGGG - Intergenic
1052747691 9:32456727-32456749 CAATTTCAGTAGATTGTTAAGGG + Exonic
1052906218 9:33836458-33836480 CAATTTTAGAATATTTTGCTGGG + Intronic
1053227472 9:36373207-36373229 CAGTTTCTTAACTTTTTTATTGG - Intronic
1055058075 9:72041789-72041811 CAATTCCAGAGTTTTTTTATTGG + Intergenic
1055234071 9:74098455-74098477 CAATTTCAGAAAATTTATATTGG + Intergenic
1055336874 9:75240694-75240716 CATTTCCAGAACAGTTTTATTGG + Intergenic
1055418622 9:76111531-76111553 TACCCTCAGAACATTTTTATTGG + Intronic
1055539047 9:77281898-77281920 CAATTGTAAAACATTGTTATAGG - Exonic
1056120351 9:83481678-83481700 CAATTTAAGAATAATTCTATGGG + Intronic
1056378943 9:86040135-86040157 CAATTTCAGAACATTTTTATTGG - Intronic
1056954645 9:91072441-91072463 TAATTTTAGCACATTTTAATAGG - Intergenic
1057334131 9:94142522-94142544 CATCTCCAGAACGTTTTTATTGG - Intergenic
1057782849 9:98063940-98063962 AAACCTTAGAACATTTTTATGGG + Intronic
1059869331 9:118554151-118554173 CAATTACAGAATCTTTTCATGGG + Intergenic
1060108543 9:120890396-120890418 ACATTTCAGTACATTTTTATGGG - Intronic
1060464457 9:123890338-123890360 CCATTTAAGCACATTTTTCTGGG - Intronic
1060708247 9:125828185-125828207 CATTTTCATCACATTTTCATTGG + Intronic
1061447111 9:130645700-130645722 CAAATTTAAAATATTTTTATGGG - Intergenic
1062395500 9:136351066-136351088 CAATTTCAGACTATTTCTAGTGG - Intronic
1185773791 X:2786102-2786124 GAAATTCAGCACATTTTTCTTGG + Intronic
1186032565 X:5385759-5385781 CAATTTTACATCATTTTGATGGG + Intergenic
1186269270 X:7867153-7867175 CAATTTCATAACAATATTCTGGG + Intergenic
1187189284 X:17017988-17018010 CCATTTCAAAACATTTTTAATGG - Intronic
1187247026 X:17562057-17562079 CAATTTCAGAACAGTAGCATAGG - Intronic
1187519671 X:20002458-20002480 TAATTCTAGAACATTTTTACCGG - Intergenic
1188739992 X:33766600-33766622 ATATTTTATAACATTTTTATTGG - Intergenic
1188949339 X:36349561-36349583 CAATATTAGAAAATGTTTATAGG - Intronic
1189087551 X:38041998-38042020 CTATTTCAGACCATTTTCTTGGG + Intronic
1189116364 X:38347068-38347090 CTAGTTCAGAACCTATTTATTGG - Intronic
1190133432 X:47772266-47772288 AAATTTCAAAAAAATTTTATAGG - Intergenic
1190680446 X:52822559-52822581 CAAATTCAAAAGATTTTTTTGGG - Intergenic
1191140591 X:57112522-57112544 TAAGTTCAGAACATTTTGCTTGG + Intergenic
1192701134 X:73474759-73474781 AAATTGCAGAATATTTTTCTGGG - Intergenic
1193373607 X:80730587-80730609 CAATTTTAGAACATTTTCATTGG - Intronic
1193517473 X:82486181-82486203 CATTTTCAGTAAATTTTTGTGGG - Intergenic
1193757332 X:85424505-85424527 CAATTTCAGATCTTGTTTATTGG + Intergenic
1193794838 X:85861382-85861404 AAATTTCAACACATTTTTTTTGG + Exonic
1193841265 X:86411457-86411479 TAATTTCAGAAGATGTGTATGGG - Intronic
1193907594 X:87261764-87261786 CAATTTCAGGACTTTATTCTTGG + Intergenic
1193946443 X:87742045-87742067 CAATTTCCACACATTTTAATTGG - Intergenic
1194157855 X:90415510-90415532 CAATTCCAGAACATGATTCTTGG - Intergenic
1194777607 X:97984151-97984173 CAATTTCAGTGCATTTTGAAAGG + Intergenic
1195429356 X:104771013-104771035 CCTTTTCAGAACATTTTCCTTGG - Intronic
1195546764 X:106121275-106121297 CTAATTCAGAACATATTTAAAGG - Intergenic
1195943820 X:110188524-110188546 CATTTTTTGGACATTTTTATAGG - Intergenic
1196119313 X:112031459-112031481 CAATTTCTGCACCTGTTTATTGG + Intronic
1196629013 X:117913905-117913927 TATTTTAAGAACAATTTTATAGG - Intronic
1197495111 X:127170542-127170564 CAATTTCAAGACATTTTTCTGGG - Intergenic
1198004224 X:132475645-132475667 CTATTACAGGACGTTTTTATTGG + Intronic
1198161560 X:134013568-134013590 AGATAGCAGAACATTTTTATGGG + Intergenic
1198408732 X:136343794-136343816 CAATCTCATAACGATTTTATAGG + Intronic
1199940224 X:152618979-152619001 CCATTCCAGAACTTTTTCATTGG + Intergenic
1200504184 Y:3992479-3992501 CAATTCCAGAACATGATTCTTGG - Intergenic
1201296097 Y:12464480-12464502 GAAATTCAGCACATTTTTCTTGG - Intergenic
1201304673 Y:12540598-12540620 GAATTTCAGATCATTTTTATAGG + Intergenic
1201332342 Y:12838245-12838267 GAAAAACAGAACATTTTTATTGG + Intronic