ID: 1056379711

View in Genome Browser
Species Human (GRCh38)
Location 9:86046359-86046381
Sequence CATGCACCTTCTGCTCCGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 171}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056379711_1056379714 20 Left 1056379711 9:86046359-86046381 CCGCACGGAGCAGAAGGTGCATG 0: 1
1: 0
2: 1
3: 16
4: 171
Right 1056379714 9:86046402-86046424 CAGCTTAATCCCCGCCTCCCAGG 0: 1
1: 0
2: 1
3: 36
4: 984

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056379711 Original CRISPR CATGCACCTTCTGCTCCGTG CGG (reversed) Intronic
902096490 1:13950131-13950153 CATGCACCTGCTGCTTTGTTTGG + Intergenic
903735122 1:25524941-25524963 CCTGCTCCTTCTGAGCCGTGTGG - Intergenic
906441035 1:45844933-45844955 CTTCCACCTTCTGCCACGTGAGG - Intronic
906462069 1:46042247-46042269 CAGGAATCTTCTGCTCCATGTGG - Exonic
912980806 1:114369891-114369913 CTTGCACCCTCTGCTGCATGAGG + Intergenic
915645794 1:157271025-157271047 CAAAGACCTTCTGCTCCTTGGGG + Intergenic
916524455 1:165596789-165596811 CATGAACGTTCTGATCAGTGTGG - Intergenic
920274213 1:204791994-204792016 AATTCACCTTCTTCTCCCTGAGG + Intergenic
920514472 1:206574573-206574595 CATGGAGCTTCTGCTCCATGTGG - Intronic
1063420837 10:5911506-5911528 CATCCACCTTATCCTCCATGCGG + Intronic
1067058264 10:43064748-43064770 CATCCCCCTTCTGCCCCATGTGG + Intergenic
1067420182 10:46138446-46138468 CTTGCACCCTCTGCTGCTTGAGG - Intergenic
1067425838 10:46211074-46211096 CTTGCACCCTCTGCTGCTTGAGG + Intergenic
1067505528 10:46844934-46844956 CTTGCACCCTCTGCTGCTTGAGG - Intergenic
1069625424 10:69864974-69864996 CATGCACCTGCTGCTTCCTCAGG - Intronic
1069775764 10:70926292-70926314 CAGGCACCTTGTGCTCAGGGTGG - Intergenic
1069855203 10:71436425-71436447 GATGCATATTGTGCTCCGTGAGG + Intronic
1069911326 10:71761625-71761647 CATGGACCCTGTGCTCCGAGTGG + Exonic
1071611111 10:87031766-87031788 CTTGCACCCTCTGCTGCATGAGG - Intergenic
1071707114 10:88011287-88011309 CTTGCCCTTTCTGCTCTGTGAGG - Intergenic
1073940418 10:108691618-108691640 CTTCCACCTTCTGCTATGTGAGG - Intergenic
1076566949 10:131405316-131405338 CATGCACCCTCTGCTCCCTGTGG + Intergenic
1076573660 10:131449526-131449548 CATGTCACTTCTGCTCTGTGGGG + Intergenic
1076939265 10:133590754-133590776 CCTGCATCTTCTGCTCCACGGGG + Intergenic
1077311094 11:1889429-1889451 CGGGCACCTCCTGCTCTGTGGGG + Exonic
1077311101 11:1889453-1889475 CAGGCACCTCCTGCTCTGTGGGG + Exonic
1077534216 11:3112275-3112297 CTTGCACCTTCTGCCGCATGGGG + Intronic
1078087119 11:8240631-8240653 CTTGCCCCTTCTGCCACGTGAGG - Intronic
1079340402 11:19606994-19607016 CATGCACCTTCCACACCGTATGG + Intronic
1081689756 11:45069822-45069844 CATGGACCTTCTGGACAGTGTGG + Intergenic
1084067790 11:66715308-66715330 AGTGCACTTTCTGCTCCTTGAGG + Exonic
1084093788 11:66896750-66896772 CATCCACATTGTGGTCCGTGGGG - Intronic
1084423496 11:69072036-69072058 CATGGACCCTCTTCTCCCTGAGG + Intronic
1084530942 11:69727460-69727482 CATGCCCCTCCTGCTCCCAGGGG + Intergenic
1084659169 11:70537070-70537092 CATGCTCCTTTTGCTCCCTCAGG + Intronic
1085573275 11:77578486-77578508 CTTGCACCCTCTGCTGCATGAGG + Intronic
1087142710 11:94781173-94781195 AATGCACCTTCGGGTCCTTGAGG - Intronic
1091745079 12:2986561-2986583 ACTGCACCTTCTGCTTCCTGAGG - Intronic
1097574137 12:61370155-61370177 CATCCACCTTCTGCCATGTGAGG + Intergenic
1099502916 12:83435735-83435757 CATGCACCTTCTTCACCAGGAGG - Intergenic
1102396401 12:112589705-112589727 CCTGCACCATTTGCTCCATGAGG + Intronic
1102855845 12:116292603-116292625 CATGGACCTTCTTCCACGTGAGG + Intergenic
1103717240 12:122952023-122952045 CTTCCACCTTCTGCAGCGTGAGG + Intronic
1104337838 12:127917176-127917198 CATGCGCCCTCTGCACAGTGGGG - Intergenic
1105614791 13:22001797-22001819 CATGCACCGTCTGGTCACTGTGG + Intergenic
1105889118 13:24669380-24669402 CTGGCACCTTCTTCTCTGTGAGG + Intergenic
1109318059 13:60775705-60775727 CAGGCACCTTCTTCACAGTGTGG + Intergenic
1110059042 13:71017826-71017848 CATGCACCTTCTTCACCAGGTGG - Intergenic
1110836800 13:80093034-80093056 CATGCTCCTTTAGCTCAGTGAGG + Intergenic
1112493275 13:99885645-99885667 CAGGCACCCTCAGCTCAGTGAGG - Intronic
1113560995 13:111280926-111280948 GAAGCTGCTTCTGCTCCGTGTGG + Intronic
1113947468 13:114052285-114052307 CATGAACCTGCAGCTCCCTGTGG + Intronic
1114496437 14:23136298-23136320 CATGCACCAGGTGCTCTGTGGGG + Intronic
1114501578 14:23173234-23173256 CATGCAGCTTCTGCTCTGCGTGG - Intronic
1116334023 14:43634260-43634282 CTTTCACCTTCTGCTATGTGAGG - Intergenic
1121570416 14:94942799-94942821 CATGCACCTGCTGAGCCTTGGGG - Intergenic
1124120265 15:26882922-26882944 CCTCCTCCTTCTGCTCCCTGGGG - Intronic
1124596739 15:31097413-31097435 CATGCACCCTTTGCTCTGAGAGG - Intronic
1125091923 15:35802884-35802906 CTTCCACCTTCTGCTATGTGAGG - Intergenic
1126708209 15:51427405-51427427 CTTGCACCCTCTGCTGCATGAGG - Intergenic
1130024120 15:80256448-80256470 CATGCACCTCCTGCTGCCTCTGG + Intergenic
1132738042 16:1397183-1397205 GATGGAACTGCTGCTCCGTGCGG + Intronic
1134805275 16:17118878-17118900 CCTGCACCATCTGCCCTGTGTGG + Intronic
1137738721 16:50743335-50743357 AATCCACCTACTGCTCAGTGGGG - Intronic
1138109339 16:54311223-54311245 CATTCACCTTCTTCTCAGGGTGG - Intergenic
1140458659 16:75120313-75120335 CTTGCACCCTCTGCTGCATGAGG + Intergenic
1142107891 16:88316008-88316030 CATGCACCTGCAGCTCTGTAGGG + Intergenic
1142408902 16:89906333-89906355 CACGTCCCTTCTGCTCCGGGCGG + Intronic
1143110034 17:4547975-4547997 CCAGCACCTTCTGCTCCTCGTGG - Exonic
1144417755 17:15068182-15068204 CGTTCACCTTCTGCTATGTGAGG - Intergenic
1145886344 17:28384832-28384854 CATCCACCTGCTGCTCCTGGGGG - Exonic
1147320458 17:39642837-39642859 CTTGCACCTGCTGCTCTGTCGGG - Intronic
1147900754 17:43782332-43782354 CTTTCTCCTTCTGCCCCGTGAGG - Intronic
1150166709 17:62950938-62950960 CATGCACCTCCTGCTGCTGGAGG - Intergenic
1150221217 17:63496918-63496940 CATGCAGCTCGTTCTCCGTGCGG - Exonic
1152721343 17:81925191-81925213 CATGCACCCTCTGCTCCCAGAGG + Intronic
1153736718 18:8078315-8078337 CATGTATCTTCAGCTCCGGGAGG - Intronic
1153967642 18:10196190-10196212 CTTGCTCCTTCTGCCACGTGAGG - Intergenic
1154223530 18:12478862-12478884 CATCCACCTACTGCCCCTTGTGG - Intronic
1158706912 18:59800899-59800921 CATGCACCTGGTGCTCTGGGTGG + Intergenic
1165383894 19:35499243-35499265 CATGCAGCTTCTACTGCCTGTGG - Intronic
1165775254 19:38400598-38400620 CAGGCTCCTTCTGCTGCATGTGG + Intergenic
1166320629 19:42016483-42016505 CATGCACCCTCTGGCCCCTGAGG + Intronic
1168438841 19:56346052-56346074 CTTGCACCCTCTGCTGCATGAGG - Intronic
926172140 2:10559138-10559160 CATGCAGCTGCTGCGCGGTGGGG + Intergenic
928909546 2:36405416-36405438 CATGGACCTTCAGCTCCGTATGG - Intronic
929534929 2:42775677-42775699 CCTGCACCCTCTGCTGCATGAGG + Intronic
929547162 2:42863208-42863230 CATGCAGCTTTTGCTAGGTGAGG + Intergenic
931767340 2:65468468-65468490 CATTCATCTTCTGCTCCCTGGGG + Intergenic
934731049 2:96658157-96658179 CAGGCACCTGCTACTACGTGTGG + Intergenic
935152902 2:100454377-100454399 CTTGCACCCTCTGCTGCATGAGG + Intergenic
936398516 2:112148697-112148719 CATGCAGGCTCTGCTCCGTGAGG + Intronic
939326377 2:140695062-140695084 CATTCATCTTCTGCTTGGTGGGG + Intronic
941735351 2:168969056-168969078 CATGAAGCTTCTACTGCGTGCGG + Intronic
943262079 2:185678815-185678837 CTTGCACCCTCTGCTGCATGAGG - Intergenic
943295128 2:186128763-186128785 CATGCTACATCTGCTCTGTGTGG - Intergenic
945439609 2:209863780-209863802 CATGCTCCTTTAGCTCAGTGTGG + Intronic
945868951 2:215206353-215206375 CTTGCACCCTCTGCTGCATGAGG + Intergenic
948222662 2:236285333-236285355 CTTCCACCTTCTGCTATGTGAGG + Intergenic
1169301278 20:4443841-4443863 CTTCCACCTTCTGCTACGTGAGG - Intergenic
1169333226 20:4732859-4732881 AATGCAGCTTCTGCTTCGTCAGG + Exonic
1169479173 20:5962097-5962119 CAGGCATCTTCTTCTCCATGTGG + Intronic
1169498013 20:6133287-6133309 CAGGCTCTTTCTGCTCCATGGGG + Intergenic
1171108363 20:22457571-22457593 CTTGCAACTTCTGCCCAGTGAGG - Intergenic
1171506736 20:25642443-25642465 CCTGCACCTTCTGCTGCATGAGG - Intergenic
1174349060 20:49954137-49954159 CATGCGGCTTCTGCTACGTGCGG + Intergenic
1177589480 21:23144254-23144276 CTTGCACCCTCTGCTGCATGAGG - Intergenic
1178605622 21:34034207-34034229 CATGCACCTCTTGATACGTGGGG + Intergenic
1179243899 21:39613463-39613485 CAGGCAGCTTCTGCATCGTGGGG + Intronic
1180937841 22:19637756-19637778 CATGCAGCATCTGCACCGTGGGG + Intergenic
1182346995 22:29673418-29673440 CCAGCACCTTCTGCTCCATCAGG - Exonic
1183346567 22:37311491-37311513 CATCCACCTTCTGCACCGAGAGG - Exonic
949153145 3:794525-794547 CTTGCACCTTCTTCCACGTGAGG + Intergenic
950285459 3:11741305-11741327 CTTCCACCTTCTGCTGTGTGGGG - Intergenic
950491179 3:13305932-13305954 CCTGCTCCTACTGCTCCTTGGGG + Intergenic
950918855 3:16672319-16672341 CTTGCACCTTCTGTTGCATGAGG + Intergenic
952568319 3:34683711-34683733 CATGACCCTTCTGCTCCATCAGG - Intergenic
953418183 3:42734817-42734839 CAGGCACCTTCACCTCCCTGGGG - Intronic
954196733 3:49001607-49001629 TGGGCACCTTCAGCTCCGTGAGG + Exonic
960470999 3:118065132-118065154 CTTCCACCTTCTGCTCTGTGAGG - Intergenic
961173464 3:124815552-124815574 AGTGCACCTTCTGCCCTGTGGGG + Intronic
961374148 3:126451396-126451418 CATGCTGCTGCTGCTCAGTGCGG - Intronic
968465550 4:748340-748362 CAGGCACCTGCCGCTCCGTCTGG + Intronic
971692843 4:29859611-29859633 CTTGCATCTTCTGCTGCATGGGG + Intergenic
973720478 4:53718847-53718869 TTTGCCCCTTCTGCTACGTGAGG + Intronic
974935653 4:68407030-68407052 CTTGCACCCTCTGCTGCATGGGG + Intergenic
978500887 4:109408927-109408949 CATTCTCTTTCTGCTCAGTGGGG - Intergenic
982071542 4:151699589-151699611 CATGGAGCTTATGCTCAGTGAGG + Intronic
983503581 4:168527957-168527979 CATCCACCTTCTGTTCCTTTAGG + Intronic
983822372 4:172211801-172211823 CTTGCCCTTTCTGCTACGTGAGG - Intronic
984305413 4:177983187-177983209 TTTGCACCTTCTGCCCTGTGAGG + Intronic
984983195 4:185302622-185302644 CTTGCACCTTCTGCCATGTGAGG + Intronic
986116927 5:4784441-4784463 CAGGCACCTTCTTCACGGTGTGG + Intergenic
986634594 5:9808903-9808925 CCTGCTCCTCCTGCTCCATGGGG - Intergenic
990350869 5:54914585-54914607 CATTCACCTCCTGCTCTGTAAGG + Intergenic
990780537 5:59356922-59356944 CAAGTGCCTCCTGCTCCGTGCGG - Intronic
994667208 5:102719979-102720001 CCTGCTCCTTCTGCTATGTGAGG - Intergenic
995744967 5:115393731-115393753 CATGCACTTTCTCCTCTCTGAGG - Intergenic
997285358 5:132674170-132674192 TACTCACCTTCTGCTCTGTGAGG - Exonic
998827461 5:146117681-146117703 CATGCTCTTTCTGCTTCTTGTGG + Intronic
999329520 5:150662947-150662969 CTGGCCCCTTCTGCTCCTTGGGG - Exonic
999350969 5:150871505-150871527 CTTGCACCCTCTGCTGCATGAGG + Intronic
999358378 5:150958777-150958799 CTTGCACCCTCTGCTGCATGAGG + Intergenic
1004646603 6:17568174-17568196 CTTGCACCGTCTGCTGCATGGGG - Intergenic
1005681954 6:28216927-28216949 CATGCAGCCTCTTCTCCCTGGGG - Intergenic
1007275392 6:40669566-40669588 CTTCCACCTTCTGCCACGTGAGG + Intergenic
1007971762 6:46058858-46058880 CATGCAACTGCTGCTGAGTGTGG - Intronic
1013391515 6:109690562-109690584 CACGCACCTGCTGCTTGGTGGGG + Intronic
1013685913 6:112582244-112582266 AATGCACATTATGCCCCGTGAGG + Intergenic
1013893610 6:115057322-115057344 CATGCATCTTCTCCTGCCTGTGG + Intergenic
1015195831 6:130523979-130524001 CATACTCCCTCTGCTACGTGAGG + Intergenic
1016932750 6:149426390-149426412 CCTGCACCTTCAGCACCATGAGG + Intergenic
1018992435 6:168684467-168684489 CATACATGTTCTGCTGCGTGGGG + Intergenic
1020056500 7:5121244-5121266 CATGCAGCTTCTCCCTCGTGTGG + Intergenic
1020171401 7:5847729-5847751 CATGCAGCTTCTCCCTCGTGTGG - Intergenic
1024087733 7:45910511-45910533 CAGGCAACTTCTGCTCCCTGGGG - Intergenic
1024726032 7:52196181-52196203 CAGGCACCTTCTTCACAGTGTGG - Intergenic
1024821716 7:53338506-53338528 CTTGCACCCTCTGCTGCATGAGG + Intergenic
1031490167 7:122377579-122377601 TTTGCACCTTCTTCTCTGTGAGG - Intronic
1032470813 7:132177620-132177642 CACCCTCCTTCTGCTCCCTGTGG - Intronic
1033679455 7:143579844-143579866 CATGCACCTTTAGCTCAGAGAGG + Intergenic
1033692381 7:143749599-143749621 CATGCACCTTTAGCTCAGAGAGG - Intergenic
1034964162 7:155381578-155381600 CTTGCATCTTCCGCTCCGAGGGG + Intergenic
1035466795 7:159084632-159084654 CCTGCACTTTCTGCAGCGTGAGG - Intronic
1041260913 8:56019849-56019871 CATGCACATCCTGCCCAGTGTGG + Intergenic
1042173572 8:66016435-66016457 CAGGCACCTTCTTCCCAGTGTGG - Intergenic
1043969796 8:86516170-86516192 CAGGCACCTTTTGGTCTGTGGGG - Intronic
1046395263 8:113632707-113632729 CATGCACTTCCTCCTCTGTGAGG - Intergenic
1047183329 8:122609921-122609943 CAGGCACCTTCTTCACAGTGTGG - Intergenic
1047530922 8:125674587-125674609 CATACATCTTCTCCTCTGTGTGG + Intergenic
1047765877 8:127989552-127989574 CCTGCACCTTCTGCTACAAGTGG - Intergenic
1048697949 8:137049749-137049771 CATTCACCTCCTGCTCACTGGGG - Intergenic
1049348859 8:142153408-142153430 CCTGCACCTTCTGCTGCCAGCGG - Intergenic
1049402514 8:142435881-142435903 CATGCACCCCCTGCTGCCTGGGG - Intergenic
1050835764 9:10076695-10076717 CATGCCCCTTGTGCTGCCTGGGG + Intronic
1053458624 9:38251171-38251193 TATGCACCTTCTGTTCAGAGAGG + Intergenic
1055893852 9:81152870-81152892 CTTGCACCTTCTGCTATGTGAGG - Intergenic
1056379711 9:86046359-86046381 CATGCACCTTCTGCTCCGTGCGG - Intronic
1056798427 9:89674941-89674963 CAAGCACCTTCTAGTCCCTGGGG + Intergenic
1057364256 9:94404039-94404061 CTTCCACCTTCTGCTTTGTGAGG + Intronic
1057659078 9:96984032-96984054 CTTCCACCTTCTGCTTTGTGAGG - Intronic
1059506730 9:114806010-114806032 CATGCTCCTGCTGCTCCTGGAGG + Exonic
1062150636 9:135017051-135017073 CTGGCACCTCCTGCTCTGTGAGG - Intergenic
1188900944 X:35732971-35732993 CATGCTCCTTTAGCTCAGTGAGG + Intergenic
1189537508 X:41950930-41950952 CATGCACATTCTTCTGCTTGGGG - Intergenic
1189963637 X:46349840-46349862 TTTGCCCCTTCTGCTCTGTGAGG - Intergenic
1192416642 X:70987050-70987072 CAAGCACCTTCTGCACAGGGTGG + Intergenic
1197029486 X:121796796-121796818 CAGGCACCTTCTACTCCATGAGG - Intergenic
1199887786 X:152039235-152039257 CTTGCACCCTCTGCTGCATGGGG - Intergenic