ID: 1056381012

View in Genome Browser
Species Human (GRCh38)
Location 9:86057506-86057528
Sequence CCTCAGCTGCACCCCGGCTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 253}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056381012_1056381019 10 Left 1056381012 9:86057506-86057528 CCCGAGCCGGGGTGCAGCTGAGG 0: 1
1: 0
2: 2
3: 25
4: 253
Right 1056381019 9:86057539-86057561 AAACAGAACCCCCCACTCCCAGG No data
1056381012_1056381020 15 Left 1056381012 9:86057506-86057528 CCCGAGCCGGGGTGCAGCTGAGG 0: 1
1: 0
2: 2
3: 25
4: 253
Right 1056381020 9:86057544-86057566 GAACCCCCCACTCCCAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056381012 Original CRISPR CCTCAGCTGCACCCCGGCTC GGG (reversed) Intronic
900222566 1:1517150-1517172 CCGCATCTGCACCCAGGATCAGG - Exonic
900238569 1:1604028-1604050 CCTCAGCTTCACCCCTCCACTGG - Intergenic
900306753 1:2013695-2013717 CCTCAGCAGCAACCCAGCACTGG + Intergenic
900513187 1:3069829-3069851 CCTCCGCCCCTCCCCGGCTCGGG - Intronic
900561838 1:3311055-3311077 CCTCAGCTGAACCCGGCCCCAGG + Intronic
900598319 1:3492566-3492588 CCTCAGCTCCACCCTGGCAGAGG - Intronic
902830807 1:19011046-19011068 CCTCGGCTGGACGCGGGCTCTGG - Intergenic
902834121 1:19035800-19035822 GCTGAGCTGCGCCCTGGCTCTGG - Intergenic
903263416 1:22143110-22143132 CCGCCGCCGCATCCCGGCTCTGG - Intronic
904339403 1:29824476-29824498 CCTCAGCCGCACCCAGCCTGGGG - Intergenic
904818960 1:33228048-33228070 CCTCAGTTGCCCCCTGGCTCTGG + Intergenic
907372168 1:54010632-54010654 CCTCAGTTCCTCCCCAGCTCTGG + Intronic
909284010 1:73791429-73791451 CCTCACTTGCACCACAGCTCAGG + Intergenic
909392382 1:75132386-75132408 GCGCAGCTGCACCCCGGGACAGG + Intronic
913513189 1:119581062-119581084 CCTCCTCTGCACCACTGCTCGGG - Intergenic
914392806 1:147237162-147237184 CCTCAGCTCCAACCTTGCTCTGG + Intronic
918053112 1:180991709-180991731 CCTCACCAGCACCCCTGCTCTGG - Intronic
918434219 1:184494944-184494966 GCTCAGCTGTACCCAGGCACAGG + Intronic
922621845 1:226994718-226994740 CCTCAGCTGCAGCAGGGTTCGGG - Intronic
924804026 1:247348224-247348246 CCCCAGCTGCACCCCTGCAAGGG - Intergenic
924907665 1:248473677-248473699 CCTCAGCTCCAGCCAGGGTCAGG - Exonic
924916443 1:248574409-248574431 CCTCAGCTCCAGCCAGGGTCAGG + Exonic
1063387691 10:5626390-5626412 CCACTGCTGCGGCCCGGCTCAGG + Intergenic
1063663168 10:8047598-8047620 CCACCTCTGCACCCCAGCTCGGG - Intergenic
1067213227 10:44279049-44279071 GCTCTGCTGCTCCCAGGCTCTGG + Intergenic
1069595254 10:69666061-69666083 CCTCAGCTGCACTCCTGGTGCGG - Intergenic
1069604758 10:69732206-69732228 CCTCAGCTGCACCATGGGTTTGG - Intergenic
1069914563 10:71779481-71779503 TCTCACCTGCACACCCGCTCAGG + Intronic
1070382049 10:75890047-75890069 CCTCTGATGCAACCCAGCTCAGG + Intronic
1075040575 10:119104243-119104265 CCTCTGCTCCACCTCGGCCCGGG + Intronic
1075736977 10:124670046-124670068 CATCAGCCTCACCCTGGCTCTGG - Intronic
1076310447 10:129502599-129502621 CCTCAGCTGCAGCCTTCCTCAGG - Intronic
1076824866 10:132961745-132961767 CCCCTGCTGCACACCTGCTCCGG + Intergenic
1077253945 11:1572397-1572419 CCTCAGCTTCACCCCGAGCCCGG - Intergenic
1077412338 11:2409490-2409512 CCACAGCTCAACCCCAGCTCCGG + Intronic
1077485160 11:2835119-2835141 CCGCAGCTGCAAACCGGCCCTGG + Intronic
1078498329 11:11842283-11842305 CCGCAGCCGAACCCCGGCCCGGG - Intronic
1079305376 11:19316973-19316995 CCTCACCTGCACCCGGGACCAGG + Intergenic
1081812575 11:45922198-45922220 CTTCAGGTGCTCCGCGGCTCTGG + Intronic
1084154692 11:67307045-67307067 CCCCAGCTGCACCCTGGGCCTGG + Exonic
1084263984 11:67995732-67995754 CAGCAGGTGCACCCCTGCTCCGG + Exonic
1084428647 11:69099524-69099546 GCTCAGCTGTACCTCAGCTCTGG + Intergenic
1084515604 11:69636782-69636804 TCCCAGCCGCACCCCGGCCCTGG + Intergenic
1084534527 11:69748809-69748831 CGTCAGCTGCACCCCAGCATGGG + Intergenic
1084793808 11:71491151-71491173 CCTCCACAGCCCCCCGGCTCCGG + Intronic
1084872884 11:72109732-72109754 CCTCAGCTGCTGCCAGGATCTGG - Exonic
1084888507 11:72225059-72225081 CCTCCGCGGCCGCCCGGCTCAGG - Exonic
1084891074 11:72237475-72237497 CCTCAGCCCCACCACGGCCCCGG - Exonic
1084943529 11:72626780-72626802 CCTCAGCCTCACCCTGACTCTGG + Intronic
1085265415 11:75235323-75235345 CCTCAGCTGTGCCCAGGCCCAGG - Intergenic
1085793151 11:79513468-79513490 CCTCAGCATCACCCAGGGTCTGG + Intergenic
1085816126 11:79739105-79739127 ACTGAGCTTCACCCAGGCTCTGG + Intergenic
1086322446 11:85664752-85664774 CCCCCGCTGCAGCCCGGGTCAGG + Exonic
1088187375 11:107186612-107186634 CCTCAACCCCACCCAGGCTCAGG + Intergenic
1089651925 11:119920218-119920240 GCTGAGCTGGACCCGGGCTCCGG + Intergenic
1090248693 11:125236279-125236301 CCTCCTCTGCAGCCCTGCTCAGG + Intronic
1090662324 11:128891124-128891146 CCCCGGCTGCACCCCTGCTGCGG - Intergenic
1090836780 11:130459672-130459694 CCTCTGGTGCACCCGGGTTCAGG + Intronic
1091071231 11:132565499-132565521 CCTCAGCGGCTCTCCTGCTCAGG + Intronic
1091259525 11:134223771-134223793 CCCCACCGGCACCCCGGCCCGGG + Intronic
1091293161 11:134453692-134453714 CCCCAGCTGCACGGCGGCTCTGG + Intergenic
1092065695 12:5588098-5588120 CCAAAGCTGCCCCCCGCCTCTGG - Intronic
1092065724 12:5588243-5588265 CCAAAGCTGCCCCCCGCCTCTGG - Intronic
1092144104 12:6202708-6202730 CATCAGCTGCACCTAGGCTGGGG - Intronic
1096580073 12:52579478-52579500 TCTCTGCTGCAGCCCAGCTCAGG + Intergenic
1096844872 12:54400929-54400951 ACTCAGCTGTCCCCAGGCTCTGG - Exonic
1097053949 12:56239158-56239180 CCCCAGCTTCACCCCATCTCTGG + Exonic
1097182434 12:57179038-57179060 CCTCAGTTGCTCACTGGCTCTGG - Intronic
1097249600 12:57625302-57625324 CCTCACCTGCACCACTTCTCTGG - Exonic
1101493836 12:105235759-105235781 CCACAGCTCTGCCCCGGCTCAGG + Intronic
1101603550 12:106231274-106231296 CCTCAGGAGCAGCCTGGCTCTGG - Intergenic
1102474450 12:113179692-113179714 CCACAGCTGAACCTCAGCTCAGG - Intronic
1102905373 12:116670534-116670556 CCTGAGCTGCAGCCTGCCTCGGG - Intergenic
1104053046 12:125209208-125209230 CCTCGTGTGCACCCAGGCTCAGG - Intronic
1104730539 12:131103158-131103180 CCTGTGCTGAACGCCGGCTCAGG - Intronic
1104884696 12:132099975-132099997 CCTCTGCTGCACTCCACCTCAGG + Intronic
1107456769 13:40562752-40562774 TCTCATCTGCAGCCTGGCTCTGG - Intronic
1108668111 13:52652695-52652717 TCCCAGCCGCACCCCGGCCCAGG - Intronic
1111940514 13:94602011-94602033 CTTCAGCAGCACCGCGGCCCAGG + Exonic
1113152812 13:107283515-107283537 CCTCACCTGCTCCCTGGCTTGGG + Intronic
1113378581 13:109784621-109784643 CATCCGCTGCACCACGGCCCCGG - Exonic
1113875977 13:113594629-113594651 CCTCAGCTGTGCCCAGGCTTGGG + Intronic
1113937243 13:114000966-114000988 CCTCAGCTGCCTCCCTGCACAGG + Intronic
1113992397 14:16037970-16037992 CCTCAGCCGCAGCCAGCCTCTGG - Intergenic
1118312487 14:64704257-64704279 CCGCAGCCTTACCCCGGCTCTGG + Intronic
1118807468 14:69250567-69250589 CCCCAGCTGCACACAGGCCCAGG - Intergenic
1122059201 14:99125294-99125316 TCCCAGCTGCACCCAGGCTCTGG - Intergenic
1123995247 15:25713637-25713659 GCCCAGCTGCACCCCAGCTCGGG - Intronic
1124109456 15:26772964-26772986 CCTCCGCCGCGCCCCGGCACGGG + Exonic
1124477273 15:30045622-30045644 CCTCAGCTTCCCCCCGGCCCGGG + Intergenic
1125536469 15:40443291-40443313 CCTCAGCTCCATCCAGGCTGGGG - Intronic
1129162185 15:73753071-73753093 CCTCAGCAGCCCCCGGGCGCCGG + Intergenic
1129265090 15:74389046-74389068 GCTCAGCTGCAGCCTCGCTCTGG - Intergenic
1129266421 15:74395829-74395851 CCTCAGAGGCACCCCGACCCTGG - Intergenic
1130059095 15:80556856-80556878 CCTCAGCTGAACCTGGGCTCAGG - Intronic
1131291453 15:91110564-91110586 CATCTGCTGCACCCCAGATCAGG - Intronic
1131594394 15:93781986-93782008 CGCCAGCTGCCCCCTGGCTCAGG - Intergenic
1132244135 15:100281200-100281222 CCACATCAGGACCCCGGCTCCGG + Intronic
1132544005 16:524782-524804 CCTCAGCGGCCCCCCGGATGTGG + Intergenic
1132727808 16:1346286-1346308 GCTCAGCTGCACACAGGCCCTGG + Exonic
1133230769 16:4365513-4365535 CCTCTGCTGGACCCTGACTCTGG - Exonic
1133465235 16:6020991-6021013 CAGCAGGTGCACCCCAGCTCTGG - Intronic
1135976877 16:27114203-27114225 CCTCAGCTGCACCAAGCCTGTGG + Intergenic
1136911778 16:34149877-34149899 CCTCAGCCGCAGCCAGCCTCTGG - Intergenic
1137058212 16:35755378-35755400 GCTCACCTGCACCCCTGCTGTGG + Intergenic
1137757860 16:50916913-50916935 CCACAGCTGGAACCAGGCTCTGG - Intergenic
1139923936 16:70475466-70475488 TCTGAGCTGCCCCACGGCTCTGG + Exonic
1143594099 17:7903892-7903914 CCTCAGTTGCATCCTGGTTCCGG - Exonic
1143774250 17:9187289-9187311 CCTCAGTTGCTCCCTGCCTCGGG - Intronic
1144495404 17:15742224-15742246 GCTCAGCTGCAGCTCGGCCCTGG - Intronic
1145765436 17:27456046-27456068 CCTCAGCTGCAGCCCAGCCCTGG - Intergenic
1146313415 17:31788578-31788600 CCCCAACTCCACCCCAGCTCAGG + Intergenic
1146797834 17:35795385-35795407 CCTCCGGTGCAGCCCGGCTCGGG + Exonic
1148216638 17:45837039-45837061 CCTTAGCTACACCCGGGCCCAGG - Intergenic
1148509478 17:48156483-48156505 CTTGAGCTGCATCCTGGCTCCGG + Intronic
1148786350 17:50148029-50148051 GCTCAGCTGCACCCGGCCCCAGG - Intronic
1150306500 17:64089688-64089710 ACTCCCCTCCACCCCGGCTCGGG - Intronic
1151951223 17:77355278-77355300 CCCCAGCTGCTCCCCTGCTGCGG - Intronic
1152009666 17:77704467-77704489 CAGCAGCTGCACACAGGCTCAGG - Intergenic
1152078438 17:78172263-78172285 CCTCAGCTTCCCCCCGGCCCGGG + Exonic
1152353996 17:79797967-79797989 CCTGGGCTGCAGCCGGGCTCCGG - Intronic
1152538052 17:80961656-80961678 CCACAGCTGCTCCCCTGCTGGGG + Intronic
1152557676 17:81062476-81062498 CCTCAGCTGCACCCTTGCACTGG + Intronic
1152855436 17:82662830-82662852 TCCCAGCTCCACCCCGGGTCTGG - Intronic
1152928009 17:83096591-83096613 GCTCAGCTGTGCACCGGCTCAGG + Intergenic
1152929347 17:83101938-83101960 GCTCAGCTGGACTCAGGCTCGGG - Intergenic
1154502380 18:15003286-15003308 CCTCAGCTGCGCCCCCGCTCAGG - Intergenic
1160204705 18:76822888-76822910 CCTCAGCCGCCGCCCGGCCCAGG - Intronic
1160798736 19:957352-957374 CCCCAGCAGCCCCCAGGCTCTGG + Intronic
1160856818 19:1221508-1221530 CCTCAGCTCCACCCTGCTTCTGG + Intronic
1160904239 19:1445094-1445116 CCTCAGCTGAACCCTGGAGCGGG - Intergenic
1161114329 19:2488385-2488407 CCCCCAATGCACCCCGGCTCCGG - Intergenic
1161272755 19:3398985-3399007 GCTCAGCTGAACCCCCGCCCTGG - Intronic
1161767352 19:6214963-6214985 CTGCAGCTGCCTCCCGGCTCTGG + Intronic
1162221955 19:9185012-9185034 CCCCAGCCGCACCCCTCCTCTGG - Intergenic
1162531717 19:11239883-11239905 CCTGGGCTGCATCCCGGCCCCGG - Exonic
1162948892 19:14059004-14059026 CCTCAGCTCCAGCCCCGCCCAGG - Intronic
1163109900 19:15153308-15153330 CCTCACCTCCACCCCAACTCAGG + Intergenic
1165732243 19:38153206-38153228 ACACAGCTGCACGCCGGCTCTGG - Intronic
1166370050 19:42295360-42295382 CCTCAGCTGCCCCCCAGCACCGG - Exonic
1166576171 19:43840448-43840470 CCTCAGCTCCACCACAGCTGTGG - Intronic
1166836209 19:45669407-45669429 CCCCAGCGTCACCCCGCCTCAGG - Intronic
1166902564 19:46077101-46077123 GCTCAGCTGCATCCTGACTCTGG - Intronic
1166966441 19:46531967-46531989 CCTGGGCTGCACCCCGTGTCTGG - Intronic
1167245954 19:48373326-48373348 CCTCTGCTCCATCCTGGCTCAGG - Intronic
1168104270 19:54156968-54156990 CCTCCGCTGCACTCTGGCCCAGG + Exonic
1168543415 19:57231259-57231281 GCCCAGCTGCACCACAGCTCTGG - Exonic
925616294 2:5747326-5747348 TCTCAGGTGCACCCCTCCTCTGG + Intergenic
927684364 2:25160578-25160600 GCTCAGGGGCTCCCCGGCTCCGG - Intergenic
932568534 2:72924526-72924548 CCTCACCTCCACCCGGGCTCCGG - Intronic
933707002 2:85298817-85298839 CCTCAGCTGCCCCCAGGGGCAGG - Intronic
937230337 2:120394881-120394903 CCTCAGCTTCTCGACGGCTCTGG + Intergenic
938501555 2:131833458-131833480 CCTCAGCTGTGCCCCCGCTCAGG - Intergenic
941275613 2:163486941-163486963 CCTCAGCTTCAGCCTGGTTCAGG + Intergenic
947795966 2:232894204-232894226 CCTCCGCTGCAGCTCGGCCCAGG + Intronic
948819922 2:240537184-240537206 CCTCACCTGCAGCCAGGCCCAGG + Intronic
1169367271 20:5001527-5001549 GCTCCGCTGCACCCCGCCCCCGG - Intronic
1170555703 20:17513172-17513194 CCACAGCTGGACTCCGGCTGAGG + Intronic
1171331047 20:24339144-24339166 GTTCAGTTGAACCCCGGCTCTGG - Intergenic
1171769450 20:29311175-29311197 CCTCAGCCGCAGCCAGCCTCTGG + Intergenic
1171868260 20:30506203-30506225 CCTCAGCTGCAGCCAGCCTTTGG + Intergenic
1171907099 20:30908218-30908240 CCTCAGCCGCAGCCAGCCTCTGG - Intergenic
1173701424 20:45075197-45075219 CCCCAGCTCCACCCAGGCTTTGG + Exonic
1175582441 20:60111049-60111071 CCTCAGCTGCCCCCAGGGTTGGG + Intergenic
1175814001 20:61874193-61874215 CCGCAGCTGCACTCGGGGTCTGG + Intronic
1175903516 20:62369070-62369092 CCTCCGCTGTCCCCCGGCACTGG + Intergenic
1175920693 20:62449349-62449371 CCCCAGCCTCACCCTGGCTCAGG + Intergenic
1176039148 20:63055220-63055242 CCCCAGCTACACCCCAGCCCTGG - Intergenic
1176216215 20:63949181-63949203 ACTCAGCCTCACCTCGGCTCCGG + Intronic
1176551801 21:8226361-8226383 CCTCAGCCGCAGCCAGCCTCTGG - Intergenic
1176570710 21:8409360-8409382 CCTCAGCCGCAGCCAGCCTCTGG - Intergenic
1176578619 21:8453507-8453529 CCTCAGCCGCAGCCAGCCTCTGG - Intergenic
1178616958 21:34143152-34143174 CCCCTGCCCCACCCCGGCTCTGG - Intergenic
1178627590 21:34231195-34231217 CCTCTGCTCCACCCCGACCCTGG + Intergenic
1179134593 21:38668466-38668488 CCTGACCTGGTCCCCGGCTCTGG - Intergenic
1179510775 21:41871795-41871817 CCTCTCCAGCACCCAGGCTCAGG + Intronic
1179631269 21:42680104-42680126 CCTCCGCTGCCCCCGGGCTCAGG + Intronic
1180314874 22:11269547-11269569 CCTCAGCCGCAGCCAGCCTCTGG + Intergenic
1180340505 22:11614156-11614178 CCTCAGCCGCAGCCAGCCTCTGG - Intergenic
1180597736 22:16989824-16989846 CCTCAGCCTCACCCTGACTCCGG + Intronic
1181556090 22:23672430-23672452 CCTCAGCTGCTGCCAGGCTTCGG - Intergenic
1181671612 22:24427969-24427991 CTGCAGCTGCACCCGGGCTGTGG + Intronic
1182729354 22:32474872-32474894 CCTCAGCTACCCCTCAGCTCCGG + Exonic
1184455412 22:44607231-44607253 CCTCTGCTCCACCCCTGCTCAGG - Intergenic
1185310715 22:50152774-50152796 CCTCAGCGGCACCCAGACCCAGG + Intronic
1203256823 22_KI270733v1_random:143283-143305 CCTCAGCCGCAGCCAGCCTCTGG - Intergenic
949573103 3:5312218-5312240 TCTCAGCTTCACCACTGCTCAGG + Intergenic
950313967 3:11984081-11984103 CCTCAGAAGCACCCTGGCTGTGG + Intergenic
950858621 3:16128026-16128048 CCTCACCTGTTCCTCGGCTCTGG - Intergenic
953910521 3:46890437-46890459 CCTGAGCTTCACCCCTGCACAGG + Intronic
954613300 3:51957396-51957418 CCTCAGCTGCACCCATTTTCTGG + Exonic
954706442 3:52483262-52483284 GCTCAGCTGCTCCCCGGGACAGG - Intronic
954882668 3:53846288-53846310 CATCAGCTGCACCCGCCCTCGGG - Exonic
955321683 3:57979015-57979037 CCTCAGCTGCACCCTGTGCCTGG + Intergenic
961109214 3:124269277-124269299 CCTCACCCCCATCCCGGCTCAGG - Intronic
961814730 3:129543616-129543638 CCACAGCTGCAGCCTGGCTACGG - Intronic
962747855 3:138410849-138410871 CCTCATCTCCACCCCTGCTGTGG + Intergenic
962937369 3:140093143-140093165 CCTCAACTGCAGCACGGCCCAGG + Intronic
963327764 3:143881148-143881170 CCTCACCTGCAGCCCAGCTGAGG + Intergenic
968307917 3:197661719-197661741 GCTCAGCTGCACCCCTGAGCTGG - Intergenic
968644872 4:1735423-1735445 CCCCAGCTGCACACAGGCCCAGG + Intronic
968991672 4:3917448-3917470 CCTCAGGTGCTACCCGGCACTGG + Intergenic
969285610 4:6200269-6200291 CCGCTGCTGCTGCCCGGCTCGGG - Exonic
973870099 4:55157783-55157805 CCGCTCCTGCATCCCGGCTCGGG + Intergenic
975132431 4:70842476-70842498 CCACCACTGCACCCCAGCTCGGG - Intergenic
975883553 4:78939234-78939256 CCGCCGCCGCTCCCCGGCTCGGG + Exonic
977055094 4:92182118-92182140 CCTCTGCTGCTTCCCGGCTCAGG + Intergenic
985095133 4:186405848-186405870 CCTCATCTGTCCCCCAGCTCTGG + Intergenic
985553186 5:543497-543519 CCTCAGCTGCACCAGGCCTTGGG - Intergenic
985675195 5:1227293-1227315 CCTCAGCAGCACCCCAGGTGGGG - Intronic
986202039 5:5587717-5587739 CACCAGCTGCACCCCTGCCCTGG - Intergenic
990308633 5:54517891-54517913 CCTCAGGTGGGCCTCGGCTCGGG + Exonic
991599738 5:68340532-68340554 GCTCAGCTACACCACTGCTCTGG - Intergenic
997472284 5:134123708-134123730 CATCAGCTTCTCCCAGGCTCTGG - Intronic
1002641335 5:180632022-180632044 CCTCAGCTACACACCGGCCCTGG + Intronic
1002898407 6:1392148-1392170 CTCCCGCTGCACACCGGCTCAGG - Intronic
1006026149 6:31148428-31148450 CCTCAGCTGCTCCTCGGCTGAGG + Exonic
1006169214 6:32083519-32083541 CCTCTGCTGCTCCCTGCCTCAGG + Intronic
1006404329 6:33835352-33835374 CCTCAGCTTCCCACCTGCTCTGG - Intergenic
1007227797 6:40327210-40327232 CCTTGGCTGCCCCCCTGCTCAGG + Intergenic
1007576692 6:42929663-42929685 CCTCAGCTCCGGCCTGGCTCGGG - Exonic
1011751841 6:90461758-90461780 CCTCAGCTGCCACCCTGTTCAGG - Intergenic
1013441972 6:110179856-110179878 CCTCGGCTGCACCTGGGCACTGG - Exonic
1015201444 6:130586016-130586038 ACTCTGCTGTACCCCAGCTCAGG + Intergenic
1015773592 6:136792483-136792505 CTTGAGCTGCACCGCGGCGCAGG - Exonic
1015965705 6:138693450-138693472 ACTGCGCTGCACCCCGGCCCGGG - Intergenic
1016709814 6:147156715-147156737 CCTCAGCTGCAGCTCAGCCCAGG + Intergenic
1017718217 6:157226868-157226890 CCTCATCTGCAGCCCGGTTCAGG + Intergenic
1018539001 6:164856436-164856458 CCTCAGCCCCATCCCGGCTAAGG + Intergenic
1019120824 6:169802129-169802151 ACTCTGCTCCACCCAGGCTCCGG + Intergenic
1019498460 7:1352424-1352446 CCGCAGCGGCTCCCCTGCTCAGG - Intergenic
1019659897 7:2218366-2218388 CCGCAGCTGCACCAGGGCTGGGG - Intronic
1020280681 7:6648487-6648509 CCTCCACTGCTCCCCGGGTCAGG - Intronic
1020418025 7:7968767-7968789 CCCCAGCCGCACCCCGCCCCCGG - Intronic
1021903920 7:25314539-25314561 CCTCTGCTGCAACCCCACTCTGG + Intergenic
1026975308 7:74494329-74494351 CCCCAGCTGTTCCTCGGCTCAGG - Intronic
1031513290 7:122673968-122673990 CCTCAGCCGCCTCCCCGCTCAGG - Intronic
1031584071 7:123512966-123512988 CTGCATCTGCAGCCCGGCTCTGG - Intronic
1034967277 7:155399105-155399127 CCTCAGCTCCAGCCTGGCTCCGG - Intergenic
1035233779 7:157483762-157483784 CCTCACCTGCACACCGGGCCGGG - Intergenic
1035261031 7:157661738-157661760 TCTCACCTGCCCCCAGGCTCAGG - Intronic
1035323573 7:158050587-158050609 CCTCAGCTGCACACCCTCCCAGG + Intronic
1035737807 8:1901400-1901422 CCACAGCTGTCCCCTGGCTCAGG + Intronic
1035957974 8:4103993-4104015 CCCCAGCTGCACACCTGCACAGG + Intronic
1040569084 8:48592339-48592361 CCTCCTCTGCACACCGGCCCTGG + Intergenic
1044359958 8:91271551-91271573 CCTCTGCTGCTTCCAGGCTCGGG + Intronic
1047815890 8:128461887-128461909 CCTCTACTGCAGCCCTGCTCTGG + Intergenic
1049406781 8:142455143-142455165 CCTCAGCCGCACCCTGCCGCCGG + Intronic
1049509730 8:143021484-143021506 CCTCTGCTGAGCCCCGGCCCGGG - Intronic
1051780551 9:20684319-20684341 CCACCGCTGCACCCCTGCTCGGG + Intronic
1052785904 9:32828142-32828164 CTTCAGCTGCTCCAAGGCTCCGG - Intergenic
1054863431 9:69975939-69975961 CCTAAACTGCACTCCAGCTCTGG - Intergenic
1055623563 9:78150177-78150199 CCTCAGCTTCCCCCCAGCCCAGG - Intergenic
1056116934 9:83449606-83449628 CCACAGATGCACCCCTGCTCAGG + Intronic
1056251562 9:84753626-84753648 TCTCAACTGCACCCAGGCCCAGG + Intronic
1056381012 9:86057506-86057528 CCTCAGCTGCACCCCGGCTCGGG - Intronic
1056770037 9:89471600-89471622 GCTCAGGTGCACGCCAGCTCAGG + Intronic
1057124244 9:92603668-92603690 CCTCATCTGCACCCCTGCCCTGG + Intronic
1058412317 9:104747643-104747665 GGTCAGCTCCACCCCGGCGCGGG - Intergenic
1058413776 9:104764091-104764113 GGTCAGCTCCACCCCGGCGCGGG - Intergenic
1058974705 9:110115132-110115154 CCTCAGCTGCTCCCAGAGTCTGG + Intronic
1060759114 9:126233768-126233790 GCTCAGCCCCATCCCGGCTCTGG - Intergenic
1060793961 9:126502585-126502607 CCTCAGAGGCACCCCTGCTGAGG - Intronic
1060817531 9:126643021-126643043 CCTCAGCTCCTCCCAGGCTGGGG - Intronic
1060932569 9:127498040-127498062 CCTCTCCTTCACCCCTGCTCTGG - Intronic
1061405483 9:130391198-130391220 CCTCAGTGGCCCCCCGGATCCGG + Intronic
1061766129 9:132882569-132882591 CCCCAGCTCCAGCCCTGCTCTGG + Intronic
1062013396 9:134278844-134278866 CCCCAGCTGGACCTCGGCTGTGG + Intergenic
1062056546 9:134472045-134472067 GCTCAGGAGCACCCCAGCTCAGG - Intergenic
1062351517 9:136141976-136141998 CCTCAGCTCCTGCCCAGCTCTGG + Intergenic
1062498115 9:136841087-136841109 CCTCAGCTGCGCCCCCGCTCAGG + Exonic
1203472980 Un_GL000220v1:124965-124987 CCTCAGCCGCAGCCAGCCTCTGG - Intergenic
1203363182 Un_KI270442v1:235560-235582 CCTCAGCCGCAGCCAGCCTCTGG + Intergenic
1185451194 X:281240-281262 CCACACCTGTACCGCGGCTCCGG - Exonic
1186362426 X:8856513-8856535 CCTCAGCTGCTGCCAGGATCTGG - Intergenic
1186413400 X:9362940-9362962 CCTCAGCTCCTCCCTGCCTCAGG - Intergenic
1187332677 X:18354803-18354825 GCTCGGCTTGACCCCGGCTCGGG - Intergenic
1189363179 X:40368990-40369012 CCTCACCGCCACCCCGGCCCTGG + Intergenic
1190109785 X:47582506-47582528 CCCAAGCTGCAGCCCAGCTCCGG - Intronic
1195078442 X:101348946-101348968 TCTCAACGGCACCTCGGCTCTGG - Exonic
1201075145 Y:10181229-10181251 CCTCAGCCGCAGCCAGCCTCTGG - Intergenic