ID: 1056388063

View in Genome Browser
Species Human (GRCh38)
Location 9:86115954-86115976
Sequence CCAGCTAATGTTTTGTAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056388063_1056388077 26 Left 1056388063 9:86115954-86115976 CCCCCCTACAAAACATTAGCTGG No data
Right 1056388077 9:86116003-86116025 AGCTGCTCCGGAGACTGGGGTGG No data
1056388063_1056388078 27 Left 1056388063 9:86115954-86115976 CCCCCCTACAAAACATTAGCTGG No data
Right 1056388078 9:86116004-86116026 GCTGCTCCGGAGACTGGGGTGGG No data
1056388063_1056388075 22 Left 1056388063 9:86115954-86115976 CCCCCCTACAAAACATTAGCTGG No data
Right 1056388075 9:86115999-86116021 TCTCAGCTGCTCCGGAGACTGGG No data
1056388063_1056388079 30 Left 1056388063 9:86115954-86115976 CCCCCCTACAAAACATTAGCTGG No data
Right 1056388079 9:86116007-86116029 GCTCCGGAGACTGGGGTGGGAGG No data
1056388063_1056388076 23 Left 1056388063 9:86115954-86115976 CCCCCCTACAAAACATTAGCTGG No data
Right 1056388076 9:86116000-86116022 CTCAGCTGCTCCGGAGACTGGGG No data
1056388063_1056388074 21 Left 1056388063 9:86115954-86115976 CCCCCCTACAAAACATTAGCTGG No data
Right 1056388074 9:86115998-86116020 GTCTCAGCTGCTCCGGAGACTGG No data
1056388063_1056388072 14 Left 1056388063 9:86115954-86115976 CCCCCCTACAAAACATTAGCTGG No data
Right 1056388072 9:86115991-86116013 ACCTGTAGTCTCAGCTGCTCCGG 0: 62
1: 2762
2: 42332
3: 172261
4: 258999

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056388063 Original CRISPR CCAGCTAATGTTTTGTAGGG GGG (reversed) Intergenic
No off target data available for this crispr