ID: 1056395102

View in Genome Browser
Species Human (GRCh38)
Location 9:86174744-86174766
Sequence ATGAACAAGACAAATGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056395102_1056395107 23 Left 1056395102 9:86174744-86174766 CCCACCTCATTTGTCTTGTTCAT No data
Right 1056395107 9:86174790-86174812 TTGTGTTAGAATTCGTCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056395102 Original CRISPR ATGAACAAGACAAATGAGGT GGG (reversed) Intergenic
No off target data available for this crispr