ID: 1056395962

View in Genome Browser
Species Human (GRCh38)
Location 9:86181239-86181261
Sequence CTCATTATTAGACTGGTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056395962_1056395965 2 Left 1056395962 9:86181239-86181261 CCTGACACCAGTCTAATAATGAG No data
Right 1056395965 9:86181264-86181286 AACATCAGACACCTCAGTTTGGG No data
1056395962_1056395964 1 Left 1056395962 9:86181239-86181261 CCTGACACCAGTCTAATAATGAG No data
Right 1056395964 9:86181263-86181285 AAACATCAGACACCTCAGTTTGG No data
1056395962_1056395966 3 Left 1056395962 9:86181239-86181261 CCTGACACCAGTCTAATAATGAG No data
Right 1056395966 9:86181265-86181287 ACATCAGACACCTCAGTTTGGGG No data
1056395962_1056395968 15 Left 1056395962 9:86181239-86181261 CCTGACACCAGTCTAATAATGAG No data
Right 1056395968 9:86181277-86181299 TCAGTTTGGGGATGTTTTATAGG No data
1056395962_1056395970 28 Left 1056395962 9:86181239-86181261 CCTGACACCAGTCTAATAATGAG No data
Right 1056395970 9:86181290-86181312 GTTTTATAGGATACCTGGCTAGG No data
1056395962_1056395969 23 Left 1056395962 9:86181239-86181261 CCTGACACCAGTCTAATAATGAG No data
Right 1056395969 9:86181285-86181307 GGGATGTTTTATAGGATACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056395962 Original CRISPR CTCATTATTAGACTGGTGTC AGG (reversed) Intergenic
No off target data available for this crispr