ID: 1056396107

View in Genome Browser
Species Human (GRCh38)
Location 9:86182647-86182669
Sequence TAGACTGGTGTCAGGGTTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056396107_1056396116 23 Left 1056396107 9:86182647-86182669 CCAAAAACCCTGACACCAGTCTA No data
Right 1056396116 9:86182693-86182715 CCAGATTGGGGTATGTTTTATGG No data
1056396107_1056396112 10 Left 1056396107 9:86182647-86182669 CCAAAAACCCTGACACCAGTCTA No data
Right 1056396112 9:86182680-86182702 AACATCAGATGACCCAGATTGGG No data
1056396107_1056396113 11 Left 1056396107 9:86182647-86182669 CCAAAAACCCTGACACCAGTCTA No data
Right 1056396113 9:86182681-86182703 ACATCAGATGACCCAGATTGGGG No data
1056396107_1056396111 9 Left 1056396107 9:86182647-86182669 CCAAAAACCCTGACACCAGTCTA No data
Right 1056396111 9:86182679-86182701 AAACATCAGATGACCCAGATTGG No data
1056396107_1056396117 28 Left 1056396107 9:86182647-86182669 CCAAAAACCCTGACACCAGTCTA No data
Right 1056396117 9:86182698-86182720 TTGGGGTATGTTTTATGGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056396107 Original CRISPR TAGACTGGTGTCAGGGTTTT TGG (reversed) Intergenic