ID: 1056396109

View in Genome Browser
Species Human (GRCh38)
Location 9:86182655-86182677
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056396109_1056396117 20 Left 1056396109 9:86182655-86182677 CCTGACACCAGTCTAATAATAAG No data
Right 1056396117 9:86182698-86182720 TTGGGGTATGTTTTATGGTTAGG No data
1056396109_1056396116 15 Left 1056396109 9:86182655-86182677 CCTGACACCAGTCTAATAATAAG No data
Right 1056396116 9:86182693-86182715 CCAGATTGGGGTATGTTTTATGG No data
1056396109_1056396111 1 Left 1056396109 9:86182655-86182677 CCTGACACCAGTCTAATAATAAG No data
Right 1056396111 9:86182679-86182701 AAACATCAGATGACCCAGATTGG No data
1056396109_1056396112 2 Left 1056396109 9:86182655-86182677 CCTGACACCAGTCTAATAATAAG No data
Right 1056396112 9:86182680-86182702 AACATCAGATGACCCAGATTGGG No data
1056396109_1056396113 3 Left 1056396109 9:86182655-86182677 CCTGACACCAGTCTAATAATAAG No data
Right 1056396113 9:86182681-86182703 ACATCAGATGACCCAGATTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056396109 Original CRISPR CTTATTATTAGACTGGTGTC AGG (reversed) Intergenic
No off target data available for this crispr