ID: 1056396110

View in Genome Browser
Species Human (GRCh38)
Location 9:86182662-86182684
Sequence ATGTTTTCTTATTATTAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056396110_1056396118 26 Left 1056396110 9:86182662-86182684 CCAGTCTAATAATAAGAAAACAT No data
Right 1056396118 9:86182711-86182733 TATGGTTAGGACTCCTCAAAAGG No data
1056396110_1056396117 13 Left 1056396110 9:86182662-86182684 CCAGTCTAATAATAAGAAAACAT No data
Right 1056396117 9:86182698-86182720 TTGGGGTATGTTTTATGGTTAGG No data
1056396110_1056396112 -5 Left 1056396110 9:86182662-86182684 CCAGTCTAATAATAAGAAAACAT No data
Right 1056396112 9:86182680-86182702 AACATCAGATGACCCAGATTGGG No data
1056396110_1056396113 -4 Left 1056396110 9:86182662-86182684 CCAGTCTAATAATAAGAAAACAT No data
Right 1056396113 9:86182681-86182703 ACATCAGATGACCCAGATTGGGG No data
1056396110_1056396111 -6 Left 1056396110 9:86182662-86182684 CCAGTCTAATAATAAGAAAACAT No data
Right 1056396111 9:86182679-86182701 AAACATCAGATGACCCAGATTGG No data
1056396110_1056396116 8 Left 1056396110 9:86182662-86182684 CCAGTCTAATAATAAGAAAACAT No data
Right 1056396116 9:86182693-86182715 CCAGATTGGGGTATGTTTTATGG No data
1056396110_1056396119 27 Left 1056396110 9:86182662-86182684 CCAGTCTAATAATAAGAAAACAT No data
Right 1056396119 9:86182712-86182734 ATGGTTAGGACTCCTCAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056396110 Original CRISPR ATGTTTTCTTATTATTAGAC TGG (reversed) Intergenic