ID: 1056396116

View in Genome Browser
Species Human (GRCh38)
Location 9:86182693-86182715
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056396108_1056396116 16 Left 1056396108 9:86182654-86182676 CCCTGACACCAGTCTAATAATAA No data
Right 1056396116 9:86182693-86182715 CCAGATTGGGGTATGTTTTATGG No data
1056396109_1056396116 15 Left 1056396109 9:86182655-86182677 CCTGACACCAGTCTAATAATAAG No data
Right 1056396116 9:86182693-86182715 CCAGATTGGGGTATGTTTTATGG No data
1056396110_1056396116 8 Left 1056396110 9:86182662-86182684 CCAGTCTAATAATAAGAAAACAT No data
Right 1056396116 9:86182693-86182715 CCAGATTGGGGTATGTTTTATGG No data
1056396107_1056396116 23 Left 1056396107 9:86182647-86182669 CCAAAAACCCTGACACCAGTCTA No data
Right 1056396116 9:86182693-86182715 CCAGATTGGGGTATGTTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056396116 Original CRISPR CCAGATTGGGGTATGTTTTA TGG Intergenic